1. Day 5 Mapping and Visualization
Jess Vera
Phil Richmond

2. Questions?

3. Day 5 Outline Index reference genome Map reads with bowtie ~Break~
Convert SAM to BAM
Visualize on IGV
From /projects/sreadgrp/Day5/
Copy the following file to your home directory:
template.sh
$ cp /projects/sreadgrp/Day5/template.sh ./

4. Reference genome indexing
Compress the genome into a smaller, more easily searchable format
Make Index/ directory
Load bowtie module
$ module load bowtie_bowtie
Load BWA module
$ module load bwa_0.7.5a
Copy template.sh, give it a new name
$ cp template.sh newname.sh
Open jobscript with editor

5. How to Index Reference Genome
bowtie(2)-build
Command
Options
Genome.fa
Index Name
$ bowtie-build
/path/Genome.fa
Index/SGDv4Bowtie

6. How to Index Reference Genome
bwa index
Color space
option
Command
Alignment Type
Genome.fa
$ bwa index -a is /path/Genome.fa –p Index/SGDv4BWA

7. Reference genome indexing
Compress the genome into a smaller, more easily searchable format
Submit jobscript
$ qsub <jobscript.sh>
Is it running?
$ qstat –u <username>
What’s in Index/ ?
SGDv4Bowtie.1.ebwt SGDv4Bowtie.3.ebwt SGDv4Bowtie.rev.1.ebwt SGDv4BWA.amb SGDv4BWA.bwt SGDv4BWA.sa
SGDv4Bowtie.2.ebwt SGDv4Bowtie.4.ebwt SGDv4Bowtie.rev.2.ebwt SGDv4BWA.ann SGDv4BWA.pac
(11 files)

8.
Bowtie is an ultrafast, memory-efficient short read aligner geared toward quickly aligning large sets of short DNA sequences (reads) to large genomes.
We like Bowtie for single-end read alignment
Bowtie
Only local alignment of reads (no gapped alignment)
Optimized for short read lengths (25-50bp); max read length 1000bp
Reads not allowed to overlap ambiguous characters (N, Y, R)
Colorspace support (as of v0.12.0)
Bowtie2
Local, end-to-end/gapped read alignment options
Optimized for long read lengths (≥50bp); no max read length
Allows read to overlap multiple ambiguous characters (N, Y, R)
No colorspace support

9. Bowtie Alignment Options
-v Read Mismatch
Allow –v <int> mismatches in whole read
Where <int> = 0-3
Quality score is ignored
-n Seed Mismatch (default)
Allow -n <int> mismatches in seed region
Where <int> = 0-3
Seed length = -l <int>
Where <int> > 5
Seed Region
GATCGCAGAGCTCGGGCATAGCTAGCGC
Copy template.sh, give it a new name
Open jobscript with editor

10. Reference genome index
Using Bowtie
1.) index reference genome with Bowtie-build (Video 1)
2.) Command line setup or
Set options like -n or -v
Reference genome index
Alignment Output File
Read file input
$ bowtie -S –p 2 –v 2 –a index /path/RNAseq.fq bowtie-out.sam 2> bowtie_out.stderr
Bowtie by default assumes your reads are in a fastq file, for other file formats you must specify the format of the reads
$ bowtie -S –p 2–v 2 –m 1 index /path/RNAseq.fq bowtie-out.sam 2> bowtie_out.stderr

11. Submit bowtie jobscript Check that it’s running
15 min break

12. $ bowtie -S –p 2 –v 2 –a index /path/RNAseq. fq bowtie-out
$ bowtie -S –p 2 –v 2 –a index /path/RNAseq.fq bowtie-out.sam 2> bowtie_out.stderr
# reads processed:
# reads with at least one reported alignment: (92.46%)
# reads that failed to align: (7.54%)
$ bowtie -S –p 2–v 2 –m 1 index /path/RNAseq.fq bowtie-out.sam 2> bowtie_out.stderr
# reads processed:
# reads with at least one reported alignment: (23.41%)
# reads that failed to align: (7.54%)
# reads with alignments suppressed due to -m: (69.05%)

13. Bowtie Alignment Report Options
@read1
@read2
Chr3
Chr3
Chr1
Chr1
Non-uniquely mapping read
Uniquely mapping read
-a reports all valid alignments for each read
-m <int> prevents reporting reads with > int alignments
(use –m 1 to report only uniquely mapping reads)
-k <int> report up to <int> alignments for each read (default -k 1)

14. What types of data can you view on IGV?
Quantitative Data
Read pile up/coverage
.bam
.bedgraph
.wig
Qualitative Data
Annotations
.bed
.gff3
.vcf
Quantitative
Data
Coverage
IGV image showing both types
Qualitative Data
Gene Annotations
Go to for more information on file format and options

15. Quantitative Data Sorted BAM Genes
Coverage Track
Read Alignment
(colored by strand)
Genes
You must have an index of the sorted BAM file for visualization (see Video 1)

16. Quantitative Data Bedgraph and Wig file visualization Bedgraph
Plus and Minus Strand
Wig File
Plus Strand
Wig File
Minus Strand
Genes

17. Qualitative Data BED GFF GFF file example:
chr1 SGD gene ID=Gene1
chr1 SGD snRNA ID=snRNA1
BED6 file example:
chr Gene1 0 +
chr Gene2 0 -

18. BEDTools Suite
Set of useful scripts designed to conduct various tasks using bed or gff3 files

19. BEDTools Suite intersectBed – what overlaps between 2 files
mergeBed – merge together any overlapping annotations
genomeCoverageBed – convert bam to bedgraph
coverageBed – get read counts for annotations
closestBed – compare 2 files, find what’s closest to an annotation

20. Variant Call Format – VCF File
Displays genomic variant data e.g. SNP, indels
You must index a vcf file before loading onto IGV
1.) $ IGVTools index file.vcf
2.) IGV → File → Run IGVTools → Select Index Command

21. SAM → BAM → sorted.BAM → BAM index
Working With SAM Files
SAMTools: suite of scripts designed to carry out various tasks using SAM file
SAM → BAM → sorted.BAM → BAM index
$ samtools view -bS file.sam -o file.bam
$ samtools sort file.bam file.sorted → file.sorted.bam
$ samtools index file.sorted.bam → file.sorted.bam.bai
$ samtools idxstats file.sorted.bam

22. Getting Started with IGV
From /projects/sreadgrp/Day5/ copy
SGDv4.fasta
SGDv4.gff3
To /projects/sreadgrp/student/<username>/
Connect to VM, start VNC session
$ /opt/igv/2.3.8/igv.sh
In IGV:
Import SGDv4.fa genome with annotations
Save .genome file to VM home directory!!

23. Seed Alignment of Reads
Seed Region
Read1 GATCGCAGAGCTCGGGCATAGCTAGCGC
AGCTATGATCGCAGAGCTCGGGCATAGCTAGCGCTAGAGCTCGCTCGATCGATCGATC
Genome