1. From Gene To Protein DNA -> RNA -> Protein
Gene transcription is done by RNA Polymerase
RNA translation is done by ribosomes according to the genetic code.
Gene structure – promoters, introns, exons.
RNA structure – Poly A Tails, 5’ Caps, splicing.
Provides the molecular basis for mutations.

2. Where does transcription occur?
Prokaryotes
Eukaryotes

3. Transcription
RNA Polymerase synthesizes mRNA that is complementary to the gene DNA sequence.
mRNA sequences are hundreds to thousands of bases long.
Primers are 5-10 bases, no genetic information.

5. Difference of DNA to RNA Sugar and Thymine vs Uracil

7. Base pair rules are followed to transcribe portion of DNA (gene) into mRNA.
The genetic code is used to specify the order of the 20 kinds of amino acids.

8. Prokaryote RNA Polymerase binds to promoter

9. Promoter DNA sequence, part of it is A,T rich, (TATA Box)
Binds to RNA Polymerase

10. RNA Polymerase in E. Coli (Prokaryote)
Complex set of polypeptides, not a single protein (Proteins)
2 alpha proteins bind to regulatory site,determines if transcription will happen.
A Beta and beta’ catalyze RNA synthesis.
Synthesizes RNA in the 5’ to 3’ direction.
RNA is complementary to the DNA template strand, base pair rules followed. (A=U, G=C)
RNA is antiparallel to the DNA strand so that Hydrogen bonds can form.

11. Hydrogen bonds in DNA
Due to bond angles and positions the two strands must run anti-parallel.

12. Transcription Broke into 3 phases
Initiation: when RNA polymerase is attached to promoter.
Elongation: Adding bases.
Termination: When RNA polymerase detaches from DNA strand.

13. Prokaryote RNA polymerase separates the two strands of DNA and initiates transcription
5’ UTR
3’ UTR

15. Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase
Figure
Promoter
Transcription unit 5 3 3 5
DNA
Start point
RNA polymerase
Figure 17.7 The stages of transcription: initiation, elongation, and termination.

16. Nontemplate strand of DNA 5 3 3 5 Template strand of DNA
Figure
Promoter
Transcription unit 5 3 3 5
DNA
Start point
RNA polymerase 1
Initiation
Nontemplate strand of DNA 5 3 3 5
Template strand of DNA
RNA transcript
Unwound DNA
Figure 17.7 The stages of transcription: initiation, elongation, and termination.

17. Nontemplate strand of DNA 5 3 3 5 Template strand of DNA
Figure
Promoter
Transcription unit 5 3 3 5
DNA
Start point
RNA polymerase 1
Initiation
Nontemplate strand of DNA 5 3 3 5
Template strand of DNA
RNA transcript
Unwound DNA 2
Elongation
Rewound DNA 5 3 3 3 5 5
Figure 17.7 The stages of transcription: initiation, elongation, and termination.
RNA transcript

18. Nontemplate strand of DNA 5 3 3 5 Template strand of DNA
Figure
Promoter
Transcription unit 5 3 3 5
DNA
Start point
RNA polymerase 1
Initiation
Nontemplate strand of DNA 5 3 3 5
Template strand of DNA
RNA transcript
Unwound DNA 2
Elongation
Rewound DNA 5 3 3 3 5 5
Figure 17.7 The stages of transcription: initiation, elongation, and termination.
RNA transcript 3
Termination 5 3 3 5 5 3
Completed RNA transcript
Direction of transcription (“downstream”)

19. Several transcription factors bind to DNA Transcription factors
Figure 17.8 1
A eukaryotic promoter
Promoter
Nontemplate strand
DNA 5 T A T A A A A 3 3 A T A T T T T 5
TATA box
Start point
Template strand 2
Several transcription factors bind to DNA
Transcription factors 5 3 3 5 3
Transcription initiation complex forms
RNA polymerase II
Figure 17.8 The initiation of transcription at a eukaryotic promoter.
Transcription factors 5 3 3 3 5 5
RNA transcript
Transcription initiation complex

20. Nontemplate strand of DNA
Figure 17.9
Nontemplate strand of DNA
RNA nucleotides
RNA polymerase T C C A A A 3 T 5 U C T 3
end T G U A G A C A U C C A C C A 5 A 3 T
Figure 17.9 Transcription elongation. A G G T T 5
Direction of transcription
Template strand of DNA
Newly made RNA

21. Transcription Video (24:28)

22. Question 1
How can you identify which end is 5’ and 3’ of the newly synthesized mRNA strand?

23. Translation
Ribosomes read the mRNA sequence and synthesize a polypeptide. The order of the amino acid is determined by the mRNA sequence.
Broken into 3 phases:
Initiation
Elongation
Termination

25. Translation Overview

26. tRNA Stems have hydrogen bonds, complimentary bases.
Loops have no hydrogen bonds, no base pairs.
As a result of that, tRNA has very distinct shapes.

27. Aminoacyl-tRNA synthetase (enzyme)
Figure
Aminoacyl-tRNA synthetase (enzyme)
Amino acid P
Adenosine P P P
Adenosine P P i
ATP P i P i
Figure An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA.

28. Aminoacyl-tRNA synthetase
Figure
Aminoacyl-tRNA synthetase (enzyme)
Amino acid P
Adenosine P P P
Adenosine P P i
Aminoacyl-tRNA synthetase
ATP P i P
tRNA i
tRNA
Amino acid
Figure An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA. P
Adenosine
AMP
Computer model

29. Aminoacyl-tRNA synthetase
Figure
Aminoacyl-tRNA synthetase (enzyme)
Amino acid P
Adenosine P P P
Adenosine P P i
Aminoacyl-tRNA synthetase
ATP P i P
tRNA i
tRNA
Amino acid
Figure An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA. P
Adenosine
AMP
Computer model
Aminoacyl tRNA (“charged tRNA”)

31. Ribosome Consists of two subunits. Contains three sites
Large subunit (Top)
Small subunit (Bottom)
Contains three sites
E site (Exit site)
P site (Peptidyl tRNA Binding Site)
A site (Aminoacyl tRNA Binding Site)

32. P site (Peptidyl-tRNA binding site) Exit tunnel
Figure 17.17b
P site (Peptidyl-tRNA binding site)
Exit tunnel
A site (Aminoacyl- tRNA binding site)
E site (Exit site) E P A
Large subunit
Figure The anatomy of a functioning ribosome.
mRNA binding site
Small subunit
(b) Schematic model showing binding sites

33. Shine-Delgarno Sequence
Approximately 6-8 bases upstream of the AUG codon is another conserved sequence, found above all start codons, called Shine-Delgarno sequence. That sequence is AGGAGG.
Small subunit of ribosome has a complementary sequence, UCCUCC, that searches and finds that complementary sequence, and that is how it identifies where to begin translation.

34. What is the importance of the Shine-Delgarno sequence?

35. Elongation Cycle of Translation

36. Amino end of polypeptide
Figure
Amino end of polypeptide E 3
mRNA
P site
A site 5
Figure The elongation cycle of translation.

37. Amino end of polypeptide
Figure
Amino end of polypeptide E 3
mRNA
P site
A site 5
GTP
GDP  P i E P A
Figure The elongation cycle of translation.

38. Amino end of polypeptide
Figure
Amino end of polypeptide E 3
mRNA
P site
A site 5
GTP
GDP  P i E P A
Figure The elongation cycle of translation. E P A

39. Amino end of polypeptide
Figure
Amino end of polypeptide E 3
mRNA
Ribosome ready for next aminoacyl tRNA
P site
A site 5
GTP
GDP  P i E E P A P A
Figure The elongation cycle of translation.
GDP  P i
GTP E P A

40. Termination of Translation
Termination occurs when a stop codon in the mRNA reaches the A site of the ribosome
The A site accepts a protein called a release factor
The release factor causes the addition of a water molecule instead of an amino acid
This reaction releases the polypeptide, and the translation assembly then comes apart
Animation: Translation
© 2011 Pearson Education, Inc. 40

41. Release factor 3 5 Stop codon (UAG, UAA, or UGA) Figure 17.20-1
Figure The termination of translation.
(UAG, UAA, or UGA)

42. Release factor Free polypeptide 3 3 5 5 Stop codon
Figure
Release factor
Free polypeptide 3 3 5 5 2
GTP
Stop codon 2
GDP  2 P i
Figure The termination of translation.
(UAG, UAA, or UGA)

43. Release factor Free polypeptide 5 3 3 3 5 5 Stop codon
Figure
Release factor
Free polypeptide 5 3 3 3 5 5 2
GTP
Stop codon 2
GDP  2 P i
Figure The termination of translation.
(UAG, UAA, or UGA)

44. Translation Video (34:05)

45. Translation Termination

46. Gene Structure
Genes have a promoter, a coding region and a termination region.
Eukaryote genes have exon and intron structures.
Exon- what is translated
Intron- What will be cut out.

47. RNA Splicing in Eukaryotes
5’ Cap and 3’ poly A tail are enzymatically added immediately to the primary transcript.
Primary transcript is also called Heterogenous RNA, HnRNA.
5’ cap is a guanine attached to 3 phosphates.
3’ Poly A tail is ~ bases added by polyadenylate polymerase.
5’ cap helps ribosome to identify 5’ end of strand.

48. Eukaryote genes are interupted

50. Definitions of Splicing components
snRNA-small nuclear RNA, has specific base sequence.
snRNP-small nuclear ribonucleo-protein complex. Each has own snRNA and about 7 different proteins.
There are 5 different snRNP’s, each with its own distinct snRNA (U1, U2, U4, U5, or U6)
Spliceosome-complex of all the snRNA’s and work together to mediate splicing.

51. Introns were discovered by comparing the sequences of genes (NDA) and their mRNA’s
GACCCCCATCCATTGATGAGAGAAGGTCAGTTAAGCG
CTGGGGGTAGGTAACTACTCTCTTCCAGTCAATTCGC
HnRNA
CUGGGGGUAGGUAAGUACUCUCUUCCAGUCAAUUCGG
mRNA
CUG-GGG-UCA-AUU-CGG
Protein
Leu-Gly-Ser-Ile-Arg

52. Splicing with snRNP’s

53. snRNP

54. Spliceosome
Job is to hold everything together until everything is completed.

55. Alternative Splicing One gene is transcribed into HnRNA.
HnRNA processed by alternative splicing to make multiple mRNA’s that are translated to make multiple proteins from one gene.