1. Searching for the Genes that Control Seed Development
A Research Study in Arabidopsis thaliana
Joanna Naymark
HC70A Lab Spring, 2005

2. Overview of Project What we want to know about a gene:
What is the structure?
Where is it active in the Arabidopsis plant?
Are there SALK knockouts? Do multiple lines need to be analyzed?
What are the Phenotypic Effects in Arabidopsis?
Genes Studied in this Project
Gene One: At5g10510
Gene Two: At5g65510

3. What Proteins Do At5g10510 and At5g65510 Encode?
Ovule development proteins, similar to Aintegumenta
Responsible for development of Integuments (Seed Coat)

4. How Does This Protein Function?
Codons encoding
amino acids which
form the GCC-
binding portion of
the protein.
At5g and At5g are AP2
Transcription Factors

5. At5g10510 What is the Structure?
7 Exons
6 Introns
2 SALK insertions of interest

6. At5g10510 Where is it Active?
Expected activity in three
stages of Seed
No activity expected in Leaf,
Root, Stem, or Flower
RT-PCR amplifies cDNA
Results show slightly higher gene
activity in Silique than Leaf (bright-
ness of bands), but difference not as
drastic as expected (492 bp expected)

7. At5g10510 What Does the Promoter Look Like?
Expected Size:
~ 3,430 bp (Accounting
For Length of
Primers)
Actual Size:
EcoRI digestion shows
promoter isolated from
plasmid with size
~3.5 kbp

8. At5g10510 Is This Insertion the Promoter of my Gene-of-Interest?
Sequencing with SP6 and T7 Primers
SP6: 2 base pair mutations
T7: 2 base pair mutations, 2 base pair deletions
SP6
Query: 120 gaaaacgcggtaaaataacacttcatctacctGaaggacggtagataatttctttagaaa |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 4646 gaaaacgcggtaaaataacacttcatctacctaaaggacggtagataatttctttagaaa 4705
Query: 480 ttcttcacaagccttaatattttaaTtacttttaattaaagttttcgatttgatctttta ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 5006 ttcttcacaagccttaatattttaactacttttaattaaagttttcgatttgatctttta 5065 T7
Query: 646 ttaaactataaaaagatacaaaagttgcagtagagagaga--gagaatgtgcatgtagag 703
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 7396 ttaaactataaaaagatacaaaagttgcagtagagagagagagagaatgtgcatgtagag 7337

9. At5g10510 What are the Genotypes of my Plants?
Genotyping PCR using tDNA LBb1 and Gene-Specific Reverse Primer
Genotyping by PCR using Gene-Specific Forward and Reverse and tDNA LBb1 Primers
All Homozygous Wildtype Genotypes
No tDNA Bands

10. At5g10510 Continuing to Search for tDNA Inserts
Allele Two: SALK_ tDNA Insert

11. At5g10510 What are the Genotypes of the Plants with this new Salk Insertion?
Genotyping PCR Reaction Using Gene-Specific Forward
and Reverse Primers and tDNA LBb1 Primer
Heterozygous
Homozygous Mutant

12. At5g10510 What is the Exact Location of the SALK_021823 Insertion?
Exact alignment of two sequences:
Result of sequencing reaction using LBb1 primer in tDNA band of both heterozygous and homozygous mutant plants
Chromosomal gene sequence

13. At5g10510 What’s the Difference?
Expected location of tDNA insert:
3886 base pairs from start of gene
Actual location of tDNA insert:
3830 base pairs from start of gene

14. At5g10510 What are the Phenotypic Effects of This Gene?
Heterozygous Plant
Homozygous Mutant Plant (with tape)
Homozygous Wildtype Plant (above)

15. Wildtype Seeds
(82)
(83)
(Magnification 20x)

16. Are there mutations in the embryos?
Older Homozygous Mutant
Young Homozygous Mutants
(88)
(84)
Known Mutant
(90)
Titan (1)

17. Gene 2: At5g65510 What is the Structure?
6 Exons
5 Introns
Salk Insert SALK_032039

18. At5g65510 Where is it Active?
Expected activity in three stages
of seed
Not very active in the leaf, root,
stem, flower
RT-PCR reaction on reversely-
transcribed mRNA of gene
shows activity in Silique
Low activity in Leaf, as expected

19. At5g65510 What Does the Promoter Look Like?
Expected Size, According
to Promoter Primers
Actual Size of Promoter,
According To EcoR1 Digestion
~ 2.3 kbp
Size of Plasmid Vector
~3.5 kbp

20. At5g65510 Is this Insertion the Promoter?
Sequencing with SP6
1 point mutation, 2 base pair additions
Sequencing with T7
1 point mutation
SP6
Query: 220 gtgagtaatcataatactataaatatgGaaatgtacgtttgggatcattaaattattcat 279
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 181 gtgagtaatcataatactataaatatgaaaatgtacgtttgggatcattaaattattcat 240
Query: 640 taaacaaaaaggcaacaacaagcccAaaaaactgtcaaaacttggggtataaaagggaaa 699
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 601 taaacaaaaaggcaacaacaagccc-aaaaactgtcaaaacttggggtataaaagggaaa 659 T7
Query: 44 gcagcagcagcCtctatctcagcttcttctttgaaagcttaaaccaaaacaaacaaacaa 103
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2314 gcagcagcagcttctatctcagcttcttctttgaaagcttaaaccaaaacaaacaaacaa 2255

21. At5g65510 What are the Genotypes of My Plants
PCR Reaction Results, using Gene-
Specific Fw and Rv Primers only
Specific Fw and tDNA LBb1 Primers only
Genotyping Results: All 16 Plants are Homozygous Wildtype.
Expected size of ~3,100 bp
No visible bands, no tDNA insertion

22. At5g65510 Are There Any Visible Phenotypic Effects?
Since there were no successful tDNA insertions, no visible mutations exist
Leaves and
Meristem
Siliques
Flowers

23. Conclusions
Although these two genes may have important roles in seed development, no phenotypic evidence
Problem of gene masking?
Lack of tDNA inserts posed a problem
Future Experiments
Better Knockouts (Quantity, Location)
Double Mutants?