1. The Human Genome Project
DVD: “DNA: the secret of life” chapter 7
Animation from Teachers Domain
As you view the clips, fill in your notes about the Human Genome Project.

2. GENE THERAPY: What is it?
BIG PICTURE: The process of identifying disease genes and replacing them with working genes.
Inserting a normal or healthy gene into a cell to replace a defective gene.

3. THE BIG PICTURE: How does Gene Therapy Work?
If a person’s gene is defective (has a mutation) or is missing, then a problem results.
To fix this problem, if scientists can identify the gene (using information from the Human Genome Project), then they can inject a copy of the working gene into the patient using a virus.
The viruses infect cells and inject the gene.
Now the person has good copies of the gene and will start producing working proteins (hormones, enzymes, etc).

4. 2. How does Gene Therapy Work?
Use a virus to deliver the correct version of the gene to the cell.
Then the cell has the correct version of the gene.
The gene will then be used to make the correct protein for the individual.

5. MORE INFO! Viruses - A tool for gene therapy.
Viruses are Non-living things with genes inside.
They inject DNA into a cell.
The virus serves as a vector. A vector is a vehicle for moving genes.

6. 3. What are two disorders that involve defective genes?
Cystic Fibrosis
Severe Combined Immunodeficiency Syndrome (SCIDs)

7. 4. What is CYSTIC FIBROSIS?
Inherited disease that causes the body to make the incorrect protein.
The protein codes for the body to make thick and sticky mucous
This leads to infections and early death

8. 5. What is one way Cystic Fibrosis can be TREATED?
Gene Therapy!!!

9. 6. What is Severe Combined Immunodeficiency (SCID)?
A faulty gene affects a person’s ability to fight off infections and diseases.
Severely weakens the immune system.
Can lead to early death.

10. 7. What is one way SCID can be TREATED?
Gene Therapy!!!

11. 8. What are BENEFITS of Gene Therapy?
Helps cure diseases at the genetic level.

12. 9. What are CONCERNS of Gene Therapy?
Viruses may not insert the gene into the DNA properly.
The technology is expensive and only accessible to the rich.
“Playing God”

13. What is GENE THERAPY?
The process of identifying disease genes and replacing them with working genes.

15. MORE INFO! Viruses - A tool for gene therapy.
Viruses are Non-living things with genes inside.
They inject DNA into a cell.
The virus serves as a vector. A vector is a vehicle for moving genes.

16. More Gene Therapy Videos!
How does Gene Therapy Work? (2:27)
Alzheimer’s Disease (PBS) (2:49)
Finding Cures is Hard (PBS) (8:08)

17. Gene Therapy Reading SCAN the Gene Therapy QR code
Watch the short video and answer the questions.
READ “Healing Through Gene Therapy” and highlight key terms.
Answer the questions.

18. Stem Cells Ted Talks- Stem Cells (15 Min) Nova Stem Cells- Ethics
Nova Stem Cell Breakthrough- Making Stem Cells

19. STEM CELLS: Making a new Heart?!
Stem Cells- New Heart

20. 1. What are STEM CELLS? Unspecialized cells
This means they have no job in the body yet
They have the ability to become almost ANY cell in the body

21. 2. How are stem cells DIFFERENT from other cells, like heart cells or blood cells?
They are not yet DIFFERENTIATED /SPECIALIZED.
They do not have specific jobs yet.

22. 3. What are the TWO MAIN TYPES of stem cells?
EMBRYONIC stem cells
ADULT stem cells

23. Multipotent Stem Cells
Embryonic Stem Cells
Can become ANY cell of the body; come from embryos
Can become a variety of different cells
Adult Stem Cell
Multipotent Stem Cells

24. 4. Which type do scientists PREFER and WHY?
Embryonic stem cells because they are more flexible and hold more potential than adult stem cells

25. 5. Which type is more CONTROVERSIAL?
Embryonic stem cells because they come from embryos (first cells of a baby)
Using embryonic cells is controversial because it is believed that it could be ending a potential life.

26. 6. WHY is it more CONTROVERSIAL?
The embryonic stem cells are being taken from a fertilized egg and sperm.
If the stem cells are removed from the embryo the embryo will NOT be able to survive.
If the embryo is left alone, it will develop into a child.
It is believed that taking the cells from an embryo kills a potential life.

27. 7. What are the BENEFITS of stem cell research?
Holds the potential to curing disease (such as SCID and cystic fibrosis)
Use to replace worn out or damaged cells.
Used to create new organs or tissues in the body.

28. 8. What are CONCERNS of stem cell research?
Destroying a potential embryo (fertilized egg and sperm)
“Playing God”
Potential to cause disease (like cancer) if the cells are programmed incorrectly.

29. Videos – Google search for…
Stem Cells: Seeds of Hope
NOVA scienceNOW: Stem Cells Breakthrough (fast forward to 25:55)
Watch the videos on ONE COMPUTER in your groups and then TOGETHER discuss and answer the questions on your paper.
Be prepared for a whole class discussion afterwards.

30. Stem Cell Lab Complete each part with your partner/small group.
Read carefully.
Answer ALL questions.
DO NOT WRITE ON THE YELLOW LAB DIRECTION SHEET.
Write ONLY on the STUDENT RECORD Sheet

31. Part I: Background
Answer questions 1-7 based on the background reading and your notes.

32. Part 2: Picture Sort
Sort the gray cards into the correct sequence for creating a stem cell culture.
Write the sequence on your STUDENT RECORD SHEET.

33. Use the correct pippette with each sample. READ THE LABLES!!!
In Part 3: Make sure you have completed the tables before testing the samples. Refer to the color chart!
Use 5 drops of stem cells (NOT 10)
Add 1 drop of Growth Factor
Use the correct pippette with each sample. READ THE LABLES!!!

34. Finish all the questions in the lab
Finish all the questions in the lab. Write your answers in complete sentences to earn the maximum points.

35. Stem Cells: Seeds of Hope
What does Dr Snyder mean when he says stem cells are "flexible and plastic?"
In this video what evidence convinces you that stem cells can be used to cure spinal cord injury?
Dr Snyder points out that there are ethical concerns, and that there is no single answer that will please everyone. Who do you think should be the ones to decide where to obtain stem cells for medical research?

36. Cloning…what is it?
Let’s view a video to get some details

37. 2. What does cloning PRODUCE?
1. What is Cloning?
Creating a new and identical organism using biotechnology (making an exact copy!)
2. What does cloning PRODUCE?
A new organism identical to the parent organism.

38. 3. What are the STEPS to create a CLONE?
An egg is taken from a donor cell and the nucleus is removed.
The (donor) egg cell is fused with a cell from another adult (this contains the desired nucleus/DNA to be cloned).
When they fuse, the cell begins to divide.
The single cell divides until an embryo forms and is then put into a female surrogate.
The embryo develops into an offspring that is genetically identical to the donor nucleus.

39. 4. What are the BENEFITS of cloning?
Endangered species recovery
Produce organisms with medical benefits (like creating donor organs)
Creating tissues for transplants and cures for diseases

40. 5. What is the main CONCERN of cloning?
Fear of cloning humans. (is it ethical?)
“Playing God” (just because we can, should we?)

41. 6. Who is DOLLY? What happened to her?
Dolly is (was) a sheep and was the first cloned animal (from an adult).
Dolly suffered from many health issues and died at an early age.

43. How Was Dolly Cloned? Did you get it?
Answer Questions 1-6 A B C

44. Human Cloning
Video (2:54)
Answer questions 1-5 while you watch

45. Gel Electrophoresis The process: (Basic Steps) Extract DNA
Cut DNA (using restriction enzymes)
Put DNA fragments in Gel
Separate DNA by size using electric charge
Analyze DNA fragments (DNA Fingerprint)

46. Detailed Steps
a) The process of gel electrophoresis works to separate DNA fragments according to their length/size

47. Detailed Steps
b) In order to cut the DNA into fragments, restriction enzymes are used. These are specific proteins (type of organic molecule) that “recognize” specific sequences of DNA and then cut it in half.

48. Detailed Steps
c) Samples of the DNA fragments are loaded onto a gel and the electricity is turned on. (hence the name: gel electrophoresis!)

49. Detailed Steps
d) DNA fragments move through the gel due to opposite charges. The shorter/smaller strands move farther down the gel than the longer/larger strands. Since they are larger and heavier, they do not move as far down the gel.

50. Detailed Steps
e) The groups of DNA fragments show up as small lines (called bands) in the gel.
f) Now a DNA FINGERPRINT is created, which can be analyzed!

51. Detailed Steps
e) The groups of DNA fragments show up as small lines (called bands) in the gel.
f) Now a DNA FINGERPRINT is created, which can be analyzed!

52. Uses for DNA Fingerprints (and the gel electrophoresis process)
Identify a person or suspect in a crime
Determine the parents of a child
Identify and catalogue endangered, unknown, or extinct species
Determine evolutionary relationships of species

53. Where do scientists obtain DNA to be analyzed?
Any cell!
DNA is found in blood, hair, skin, saliva, bones, and more!

54. Gel Electrophoresis Simulation

55. A Closer Look at RESTRICTION ENZYMES
1. What is the role of the restriction enzyme in gel electrophoresis?

56. A Closer Look at RESTRICTION ENZYMES
2. In order for DNA to be transferred from one source to another, the DNA must be cut with restriction enzymes to allow for transfer. The following is a segment of DNA that needs to be cut with the restriction enzyme BAM1.
The BAM1 cuts at the following restriction site between the G and T.

57. How to Analyze a DNA Fingerprint
DNA Fingerprints can be used to determine paternity of a child.
Each DNA band in the child must match up to either the Mom or the Dad.
Which male is the father of this child?

58. How to Analyze a DNA Fingerprint
DNA Fingerprints can be used to match crime scene DNA to suspects.
For this type of analysis, the DNA must be an exact match.
Which suspect was at the crime scene?

59. How to Analyze a DNA Fingerprint
DNA Fingerprints can be used to identify unknown species or compare how related 2 species are.
For this type of analysis, find the species with the most similarities.
Which two species are most closely related?

60. Activity: Modeling DNA Fingerprinting
Read the introduction.
Gather materials: scissors, ruler, paper strip
I will model Part A for you first

61. Watch me first!
My DNA Sequence Strip

62. ACAGAGCAGTATATATATACCGCGC
Watch Me!
My DNA Sequence Strip
ACAGAGCAGTATATATATACCGCGC

64. When you finish… Turn in your lab sheet!
Pick up a DNA Fingerprint Practice Worksheet and complete it.
Check those answers at the SSS!

65. Take a Stand! Each group will be given a reference article to use.
You will be assigned to 1 of 3 groups to make a list of the “pros” and “cons” of one of these topics:
Stem Cell Research
Therapeutic Cloning
Human Cloning
Each group will be given a reference article to use.
As a group, generate a concise yet thorough list of reasons for and against each type of biotechnology
Be prepared to share out with the class

66. Reasons FOR
STEM CELL RESEARCH
Reasons AGAINST

67. Reasons FOR
THERAPEUTIC CLONING
Reasons AGAINST

68. Reasons FOR
HUMAN CLONING
Reasons AGAINST
HUMAN RESEARCH