1. W10 WHOT 4/17 Transcribe and translate the following DNA sequence
TACGGGCCCAAATTTAAAACT
Amino acid is to word as _______ is to sentence?

2. Protein Synthesis Challenge
Goal: Simulate the process of making an amino acid chain!
Student Roles:
-RNA Polymerase: Comes up to Nucleus (front desks) and transcribes DNA code into mRNA (remember DNA cannot leave the nucleus) and go back to your group… You cannot talk!
-tRNA: take the mRNA codon and find the anticodon in the cytoplasm (back wall) and return to your group…..You cannot talk!
-ribosome: with write down the amino acid (word)
that the tRNA carries. The tRNA needs to return the
card back to the back wall….You cannot talk!

3. WHOT 4/18
Yesterday you transcribed DNA to mRNA, then translated those into chains of amino acids (words) to make proteins (sentences).
Describe how the change of a single letter of DNA would effect the protein.
DNA  mRNA  Protein  Trait
“We are all in this together”

4. Pg 197. Mutations Notes: Mutations – a change in DNA
Mutations only effect us if they change a gene (we have lots of DNA that doesn’t code for genes)

5. Point Mutation –
Insertion –
Deletion –

6. 4/19 WHOT Sickle Cell Anemia is a single mutation of a letter of DNA.
Explain how a change in 1 letter of DNA causes joint pain.

7. To accomplish this, your protein will not be “flat”
Title: Proteins result in traits
Rules:
1 Amino Acid ever 4 cm
All any blue/red must be bonded (touching).
All Green must be bonded (touching)
All hydrophobic must be facing “inward”
All hydrophilic must be facing “outward”
To accomplish this, your protein will not be “flat”
Create one or several labeled diagrams/drawings to SHOW THE RELATIONSHIP BETWEEN PROTEIN SYNTHESIS AND RED BLOOD CELL TRAITS (normal & sickle cell).

8. Title: Proteins result in traits
Follow along with the protein story, listen and record information about the two types of red blood cell proteins. (Biology textbook pg. 170)
Normal Hemoglobin protein Sickling Hemoglobin protein
Create one or several labeled diagrams/drawings to SHOW THE RELATIONSHIP BETWEEN PROTEIN SYNTHESIS AND RED BLOOD CELL TRAITS (normal & sickle cell).

9. Spiral the toober and return items to front lab table.
Normal Cell Protein
Sickle Cell Protein
Clean up-
Carefully remove ALL push pins from the toobar and return to plastic bag.
Spiral the toober and return items to front lab table.

10. WHOT April 20th
Describe how the shape of a protein effects its function
Now write “Structure = Function”

11. Protein Folding Activity Day 2
Today’s Schedule:
If you need to re-make your 3D protein….the materials are up front. (If your done…goggle MALARIA and find out what it is!)
Complete ALL 5 Post-lab questions on pg. 90
Watch “Why is sickle cell good?”
Ryan Clark doesn’t play in Denver due to high altitude

13. Genetics Unit Test:
Unit Test – April 25th Tuesday

14. W10 WHOT 4/17 Transcribe and translate the following DNA sequence
TACGGGCCCAAATTTAAAACT
Amino acid is to word as _______ is to sentence?

15. WHOT 4/18
Yesterday you transcribed DNA to mRNA, then translated those into chains of amino acids (words) to make proteins (sentences).
Describe how the change of a single letter of DNA would effect the protein.
DNA  mRNA  Protein  Trait
“We are all in this together”

16. 4/19 WHOT Sickle Cell Anemia is a single mutation of a letter of DNA.
Explain how a change in 1 letter of DNA causes joint pain.

17. WHOT April 20th
Describe how the shape of a protein effects its function
Now write “Structure = Function”

18. Met
Lys -
Asp +