1. What is Lurking on your Pocket Change?
Tirzah Kamran1, Kayla Peña1, Oscar J. Zagalo2, Nidhi Gadura Ph.D.2,
1Forest Hills High School, 2Queensborough Community College, Bayside, NY 11364
RESULTS
Introduction
Abstract
Penny 1 (Old)
Penny 2
(New)
Nickel
Dime
Quarter
Sample 1 
   
Sample 2
Sample 3
Sample 4
Sample 5
Sample 6  
Sample 7
Sample 8
Sample 9
Sample 10
PCR Results - Gel Electrophoresis
What is DNA barcoding?
A method to characterize different species of organism using a short DNA sequence from a specific region in the genome.
In this study we used a well established mitochondrial 16S rRNA region to identify various microbes that could be on the coins in our pocket.
The purpose of this project is to understand what different types of bacteria are on our coins. Copper has long been known for its antimicrobial properties. Excess copper avidly binds to many biomolecules such as proteins, lipids, and nucleic acids, regardless of its valence state. Copper is one of the metal ions known to exert toxic effects on bacteria and other organisms. Since our coins have varying amounts of copper in it, we decided to test a hypothesis that we will find different types on bacteria on different types on coins.  In this experiment, 100 random samples of coins ranging from pennies, nickels, dimes and quarters were collected. In addition to the coins, 100% Copper and Steel chips were used as the control group to understand and compare the different bacteria growing on copper, copper alloys, and non-copper material. Bacteria was grown on LB media, and genomic DNA was then collected using DNA extraction protocol, followed by amplifying specific DNA barcoding region using PCR with 16S rRNA primers. Using Bioinformatics, we could then identify what bacteria is growing on what coins. Results showed that Nickel had most bacterial growth and different types of bacteria on it compared to any other coin.
1000 Base pair Marker
600 base pair
Heavy Metals are Antimicrobial
It has been known for a while that heavy metals kill microbes.
Coin metal composition
We hypothesize that given the heavy metal composition of our coins, most bacteria would not survive long on them. However, we anticipate finding some microbial activity on our pocket change.
approx. 450 bp
200 Base pair Marker
Penny 1 (Before 1982)
Penny 2(After 1982)
Nickel
Dime
Quarter
88% Cu, 12% Nickel ( )
95% Cu and 5% Zinc ( )
95% Cu, 5% Zinc
97.5% Zinc, 2.5% Cu
75% Cu, 25% Nickel
91.67% Cu, 8.33% Nickel
Approx. 900 bp
Table 1: This table demonstrates the growth pattern of ten out of hundred samples collected.
Pair Alignment
BLAST results reveal microbial species
Materials and Methods
Sample collection and DNA extraction:
Pocket change was collected randomly from colleagues (pennies, nickels, dimes and quarters)
DNA was extracted from these samples using Zymo DNA extraction kit.
PCR using 16s rRNA DNA primers:
Barcoding regions was amplified using PCR
16s rRNA primers used:
16S-F CGCCTGTTTATCAAAAACAT
         16S-R CCGGTTGAACTCAGATCA
Bioinformatics – DNA Subway (CSHL):
Consensus sequences were established from alignment of complementary forward sequences using DNA Subway.
These samples from the consensus sequences were correctly identified and confirmed using NCBI BLAST.
Conclusion
Acknowledgements
The lab part of the project was funded by U.S. Department of Education QCC - MSEIP Grant to Dr. Gadura.
Tirzah and Kayla were supported by Urban Barcoding Project from CSHL
It is striking that majority of the bacterial growth was on Nickel compared to Penny, Dime and Quarters. We believe that is because of the lower copper content 75% compared to much higher copper content of other coins.
Our results from the 16s rRNA with barcoding region show that there is some microbial activity on coins.
Most of the activity was that of normal human skin cells
A few of the coins had Bacillus magatarium, Cornybacterium tuberculostearium, Staphylococcus epidermis
Future Direction
Future refinements to this project could include the identification of more bacteria using media other than LB as not every bacteria can grown in this media.
REFERENCES
Elguindi, J., Hao, X., Lin, Y., Alwathnani, H. A., Wei, G., & Rensing, C. (2011). Advantages and challenges of increased antimicrobial copper use and copper mining. Applied Microbiology and Biotechnology, 91(2), doi: /s
Grass, G., Rensing, C., & Solioz, M. (2010). Metallic Copper as an Antimicrobial Surface. Applied and Environmental Microbiology, 77(5), doi: /aem
H., (n.d.) pennies worth more. Retrieved October 26, 2016, from
Mathews, S., Hans, M., Mucklich, F., & Solioz, M. (2013). Contact Killing of Bacteria on   Copper Is Suppressed if Bacterial-Metal Contact Is Prevented and Is Induced on Iron by                Copper Ions. Applied and Environmental Microbiology, 79(8),                  doi: /aem
Mikolay, A., Huggett, S., Tikana, L., Grass, G., Braun, J., & Nies, D. H. (2010). Survival of bacteria on metallic copper surfaces in a hospital trial. Applied Microbiology and  Biotechnology, 87(5), doi: /s
Nurhayani, D., & Korda, A. A. (2015). The effect of nickel addition on antimicrobial, physical, and mechanical properties of copper-nickel alloy against suspensions of Escherichia coli. doi: /
Villapún, V., Dover, L., Cross, A., & González, S. (2016). Antibacterial Metallic Touch Surfaces. Materials, 9(9), 736. doi: /ma