Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA Structure and Protein Synthesis (also known as Gene Expression)

Similar presentations


Presentation on theme: "DNA Structure and Protein Synthesis (also known as Gene Expression)"— Presentation transcript:

1 DNA Structure and Protein Synthesis (also known as Gene Expression)

2 Protein Synthesis The process of making proteins… Boring stuff? Nope
This is how the information in your genes is used to build… you!

3 DNA Deoxyribonucleic Acid (DNA) is found in what part of the cell? How is the DNA organized? Chromosomes! Nucleus

4 Each strand of DNA is a POLYMER!!
Individual nucleotides are the monomers! Monomers (nucleotides) are linked to form a long polymer of single-stranded DNA In our cells, 2 DNA polymers are bonded together to form a LONG double-stranded polymer

5 The Parts of a Nucleotide
SUGAR – deoxyribose Phosphate group (PO4) Nitrogen-containing base

6 A nucleotide

7 ADENINE THYMINE CYTOSINE GUANINE
What are the 4 BASES? ADENINE THYMINE CYTOSINE GUANINE

8 A DNA POLYMER!! Strong bonds hold the nucleotides together to form a ‘backbone’. They occur between the sugar of one nucleotide and the phosphate of the next nucleotide.

9 MORE ABOUT THE BASES… Adenine always bonds to thymine Cytosine always bonds to guanine

10 Adenine –Thymine (A-T)
Cytosine-Guanine (C-G)

11 The role of DNA The material that genes are made of…
Gene - segment of DNA that carries the information necessary to build a protein. Information is encoded in the sequence (order) of the four DNA bases (ATGC). A gene is a sequence of thousands of these bases that codes for a protein!

12

13 The DNA in a single human cell = 3,000,000,000 bases (3 Billion!)
However, scientists were surprised that there are only about 30,000 genes!!

14

15 DNA is Double Stranded Molecule
The four bases that make up the genetic code (ATGC) form complimentary pairs. A pairs with T… G pairs with C. If one strand is ACGCAATTGCATT The other is TGCGTTAACGTAA This makes it possible for DNA copy it’s self…

16 What is a gene? A Segment of DNA that contains the information that codes for a protein!!!

17

18 How do genes result in proteins?
The DNA is in the NUCLEUS of the cell. Proteins are made on the ribosomes- where? In the cytoplasm! So, the information needs to leave the nucleus….. Can the DNA can leave the nucleus?

19 NO, it cannot! The information for the gene needs to be copied in a way that the information CAN leave the nucleus! This process is the 1st step in Protein Synthesis- TRANSCRIPTION

20 Transcription The information in the DNA is encoded in a molecule of RNA (Transcribed). DNA can’t leave the nucleus …a messenger (copy) is sent. RNA is the messenger. (mRNA) DNA = ATGCGTTAC RNA= UACGCAAUG

21 Transcribe this DNA sequence!
DNA: GCCTTAAGACATTGTATGCCTAGCTAG

22 TRANSLATION What do you do when you go from one language to another? You TRANSLATE! mRNA carries the instructions for building the protein It takes place on the ribosomes (cellular machine that makes the protein by joining amino acids)

23 Translation The Sequence (order) of bases in the DNA/RNA determines the amino acids in the protein! The information is translated from the language of DNA/RNA to the language of proteins.

24 What does the cell need to translate a mRNA?
mRNA- information for making the protein tRNA- type of RNA that actually translates the information from nucleic acid (RNA) to amino acid (protein) Ribosome- the “machine” where translation takes place; binds the mRNA, tRNA, and joins the corresponding amino acids (the monomers of proteins!)

25 How is the mRNA translated to make a protein?
Correct tRNA with an amino acid attached “reads” 3 nucleotides (a codon) and puts the correct amino acid in the growing polypeptide (unfolded protein!). This happens in the ribosome!!

26

27 Summary of transcription and translation
Transcription – A copy of the information in DNA for a gene is encoded into RNA (takes place in nucleus). Translation – The RNA (messenger) serves as the plan for building a protein using tRNA as the translator and the ribosome as the “machine” (takes place in cytoplasm)

28 Quick Quiz What do the letters DNA stand for?
DNA is a polymer- what is the monomer called? The “backbone” of the DNA molecule is made up of 2 parts of the monomer- what are these? There are 4 different monomers- what are they called (use WHOLE name; partial credit for letters)? How do they always pair in the double-stranded DNA molecule?

29 Quick Quiz The process where genetic information is copied from DNA to mRNA is called ___________. List 3 differences between DNA and RNA Write the complimentary RNA sequence for the following DNA sequence: AAGGCCTTAGACTGT

30 How many nucleotides (codon) are translated to 1 amino acid?
Quick Quiz, cont… The process of synthesizing a protein FROM the mRNA is called ________________. How many nucleotides (codon) are translated to 1 amino acid? What “machine” is necessary for translation to take place? What is the monomer of a protein?

31 Make a Diagram Showing the Transcription and Translation
Include: Cell Nucleus, DNA, DNA bases, RNA bases, Ribosome. ribososme DNA GATTACAGATTA

32 Transcription ribosome Translation Nucleus DNA GATTACAGATTA protein
mRNA Transcription mRNA ribosome Translation

33


Download ppt "DNA Structure and Protein Synthesis (also known as Gene Expression)"

Similar presentations


Ads by Google