Presentation is loading. Please wait.

Presentation is loading. Please wait.

Supplemental PowerPoint Slides

Similar presentations


Presentation on theme: "Supplemental PowerPoint Slides"— Presentation transcript:

1 Supplemental PowerPoint Slides
Downregulation of Mir-27b Is Involved In Loss of Type II Collagen By Directly Targeting Matrix Metalloproteinase 13 (MMP13) in Human Intervertebral Disc Degeneration Hao-ran Li, MD, Qing Cui, MD, Zhan-yin Dong, MD, Jian-hua Zhang, MD, Hai-qing Li, MD, and Ling Zhao, MD The Department of Spine Surgery, Cangzhou hospital of integrated traditional and western medicine, Cangzhou, Hebei, China Copyright © 2015 Lippincott Williams & Wilkins. Unauthorized commercial reproduction of this slide is prohibited

2 a b d c e 4/26/2018

3 hsa-miR-27b 3' CGUCUUGAAUCGGUGACACUU 5'
MMP13 3'UTR WT '...GGAGAAAGCUUGGUU-CUGUGAAC 3' (seed sequence, position ) MMP13 3'UTR MUT 5'...GGAGAAAGCUUGGUU-CACAGUAC 3' MMP13 GAPDH Untreated Scramble miR-27b mimic d a b c 4/26/2018

4 a b c d 4/26/2018

5 We identified that miR-27b was lower in human degenerative NP tissues and that its level was associated with disc degeneration grade. The downregulation of miR-27b induces type II collagen loss by directly targeting MMP13, leading to the development of IDD. Strategies to maintain the expression or to prevent the repression of miR-27b have the potential to become a possible therapeutic strategy for human IDD. 4/26/2018


Download ppt "Supplemental PowerPoint Slides"

Similar presentations


Ads by Google