1. 100 50 70 90
Temperature oC
Percent hyperchromicity
DNA melting curve
Tm is the temperature at the midpoint of the transition
Hyperchromicity can be used to follow the denaturation of DNA as a function of increasing temperature. As the temperature of a DNA solution gradually rises above 50 degrees C, the A-T regions will melt first giving rise to an increase in the UV absorbance. As the temperature increases further, more of the DNA will become single-stranded, further increasing the UV absorbance, until the DNA is fully denatured above 90 degrees C. The temperature at the mid-point of the melting curve is termed "melting temperature" and is abbreviated Tm. The Tm for a DNA depends on its average G+C content: the higher the G+C content, the higher the Tm. Note: G+C content, G-C content, and GC content are equivalent terms.

2. Tm is dependent on the G-C content of the DNA
E. coli DNA is
50% G-C
Percent hyperchromicity 50 60 70 80
This slide shows the dependence of Tm on average G+C content of three different DNAs. Under the conditions used in this experiment, E. coli DNA which has an average G+C content of about 50%, melted with a Tm of 69 degrees C. The curve on the left represents a DNA with a lower G+C content and the curve on the right represents a DNA with a higher G+C content. Tm is dependent on the ionic strength of the solution. At a fixed ionic strength there is a linear relation between Tm and G+C content.
Temperature oC
Average base composition (G-C content) can be
determined from the melting temperature of DNA

3. Genomic DNA, Genes, Chromatin
a). Complexity of chromosomal DNA
i). DNA reassociation
ii). Repetitive DNA and Alu sequences
iii). Genome size and complexity of genomic DNA
b). Gene structure
i). Introns and exons
ii). Properties of the human genome
iii). Mutations caused by Alu sequences
c). Chromosome structure - packaging of genomic DNA
i). Nucleosomes
ii). Histones
iii). Nucleofilament structure
iv). Telomeres, aging, and cancer

4. Complexity of chromosomal DNA: DNA reassociation (renaturation)
The complexity of a DNA is a function of how many base pairs it has.
In low complexity = few hundred
High complexity = millions of base pairs.
Low complexity sequences are able to find each other much faster during a renaturation reaction, than are high complexity sequences, since the low complexity sequences have to make fewer collisions to find a base-pairing partner.
Thus, the rate of a renaturation reaction is a function of the complexity of the DNA. Or in other words, the complexity of a DNA can be determined by measuring its second-order reassociation rate constant (k2).

5. DNA reassociation (renaturation)
Double-stranded DNA
Denatured,
single-stranded
DNA
Faster,
zippering
reaction to
form long
molecules
of double-
stranded
DNA k2
Denaturation of a DNA double helix produces single-stranded DNA. The reverse reaction (the formation of double-stranded DNA) can be carried out if the complementary DNA strands are incubated under conditions that will promote renaturation (reassociation). This process involves two steps. The first step is a slower, rate-limiting reaction in which the complementary strands attempt to find each other. The single strands randomly interact until complementary base pairing can occur. This may occur over only a short region of each strand, but may be enough to "nucleate" the reaction. Because the two reacting strands are at the same concentration in solution, the reaction is second-order, with the rate of the reaction being defined by the second-order rate constant, k2. Once nucleation has occurred, the complementary strands rapidly zipper up. The complexity of a DNA is a function of how many base pairs it has. In other words, a low complexity DNA may consist of a few hundred or a few thousand base pairs, in contrast to a high complexity DNA that may contain millions of base pairs. Low complexity sequences are able to find each other much faster during a renaturation reaction, than are high complexity sequences, since the low complexity sequences have to make fewer collisions to find a base-pairing partner. Thus, the rate of a renaturation reaction is a function of the complexity of the DNA. Or in other words, the complexity of a DNA can be determined by measuring its second-order reassociation rate constant.
Slower, rate-limiting,
second-order process of
finding complementary
sequences to nucleate
base-pairing

6. Type of DNA % of Genome Features
1. Single-copy (unique) ~75% Includes most genes 1
2. Repetitive
a- Interspersed ~15% Interspersed throughout genome
between and within genes; includes Alu sequences 2and VNTRs or mini (micro) satellites
b- Satellite (tandem) ~10% Highly repeated, low complexity sequences
usually located in centromeres
and telomeres
2 Alu sequences are
about 300 bp in length
and are repeated about
300,000 times in the
genome. They can be
found adjacent to or
within genes in introns
or nontranslated regions.
1 Some genes are repeated a few times to thousands-fold and thus would be in
the repetitive DNA fraction
fast ~10%
intermediate
~15% 50
The human genome consists of three populations of DNA: the fast and intermediate fractions make up about 10% and 15% of the genome, respectively, and the slow fraction makes up about 75% of the genome. Most of the genes in the human genome are in the single-copy fraction. As shown in the next slide, repeated sequences can be of two types: those that are interspersed throughout the genome or those that are tandemly repeated satellite DNAs. Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about 300 base pairs in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to the occasional disruption of genes. The interspersed repetitive sequences also include VNTRs (variable numbers of tandem repeats), which are comprised of short repeated sequences of only a few base-pairs, but of variable lengths. They, too, are interspersed throughout the genome, and are quite useful as landmarks for mapping genes because they are highly polymorphic (they differ in length or number of repeats from individual to individual).
slow (single-copy)
~75%
100
I I I I I I I I I

7. Classes of repetitive DNA
Interspersed repeats are sequences that are repeated many times and scattered throughout the genome.
In contrast, tandem repeats are sequences that are repeated many times adjacent to each other. They are usually found in the centromeres and telomeres of chromosomes (the sequence above TTAGGG comprises human teleomeric DNA

8. Classes of repetitive DNA
Interspersed (dispersed) repeats (e.g., Alu sequences)
GCTGAGG
GCTGAGG
GCTGAGG
Tandem repeats (e.g., microsatellites)
Interspersed repeats are sequences that are repeated many times and scattered throughout the genome. In contrast, tandem repeats are sequences that are repeated many times adjacent to each other. The latter are usually found in the centromeres and telomeres of chromosomes (the sequence above TTAGGG comprises human teleomeric DNA – see last slide of this series).
TTAGGGTTAGGGTTAGGGTTAGGG

9. Human Genome Project
Knowing the complete sequence of the human genome will:
allow medical researchers to more easily find disease-causing genes.
understand how differences in our DNA sequences from individual to individual may affect our predisposition to diseases and our ability to metabolize drugs.
Because the human genome has ~3 billion bp of DNA and there are 23 pairs of chromosomes in diploid human cells, the average metaphase chromosome has ~130 million bp DNA.

10. Genome sizes in nucleotide pairs (base-pairs)
plasmids
viruses
bacteria
fungi
plants
algae
insects
mollusks
bony fish
The size of the human
genome is ~ 3 X 109 bp;
almost all of its complexity
is in single-copy DNA.
The human genome is thought
to contain ~30,000 to 40,000 genes.
amphibians
On June 26, 2000, the Human Genome Project and Celera Genomics Corp. jointly announced that the sequencing of the human genome was all but completed. A so-called rough draft of approximately 90% of the genome was completed and ready for release to scientists and medical researchers at that time. A rough draft was released to make the sequence available as soon as possible while completion of the remaining sequence took place. What still needs to be done is to fill in some difficult-to-sequence gaps and to find "typographical errors" in the sequence. Knowing the complete sequence of the human genome will allow medical researchers to more easily find disease-causing genes. In addition, it should become possible to understand how differences in our DNA sequences from individual to individual may affect our predisposition to diseases and our ability to metabolize drugs. Because the human genome has ~3 billion bp of DNA and there are 23 pairs of chromosomes in diploid human cells, the average metaphase chromosome has ~130 million bp DNA.
reptiles
birds
mammals
104
105
106
107
108
109
1010
1011

11. Gene Structure
Most genes in the human genome are called "split genes" because they are composed of "exons" separated by "introns."
The exons are the regions of genes that encode information that ends up in mRNA.
The transcribed region of a gene (double-ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all of the exons and introns (initiation of transcription is regulated by the promoter region of a gene, which is upstream of the +1 site).
RNA processing (the subject of a another lecture) then removes the intron sequences, "splicing" together the exon sequences to produce the mature mRNA.
The translated region of the mRNA (the region that encodes the protein) is indicated in blue. Note that there are untranslated regions at the 5' and 3‘ ends of mRNAs that are encoded by exon sequence but are not directly translated.

12. Gene structure promoter region
exons (filled and unfilled boxed regions) +1
introns (between exons)
transcribed region
This slide shows the structure of a typical human gene and its corresponding messenger RNA (mRNA). Most genes in the human genome are called "split genes" because they are composed of "exons" separated by "introns." The exons are the regions of genes that encode information that ends up in mRNA. The transcribed region of a gene (double-ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all of the exons and introns (initiation of transcription is regulated by the promoter region of a gene, which is upstream of the +1 site). RNA processing (the subject of a another lecture) then removes the intron sequences, "splicing" together the exon sequences to produce the mature mRNA. The translated region of the mRNA (the region that encodes the protein) is indicated in blue. Note that there are untranslated regions at the 5' and 3‘ ends of mRNAs that are encoded by exon sequence but are not directly translated.
mRNA structure 5’ 3’
translated region

13. The (exon-intron-exon)n structure of various genes introns can be very long, while exons are usually relatively short.
Next figure shows examples of the wide variety of gene structures seen in the human genome. Some (very few) genes do not have introns. One example is the histone genes, which encode the small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4.
Shown here is a histone gene that is only 400 base pairs (bp) in length and is composed of only one exon.
The beta-globin gene has three exons and two introns.
The hypoxanthine-guanine phosphoribosyl transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually relatively short.
An extreme example of this is the factor VIII gene which has numerous exons (the blue boxes and blue vertical lines).

14. The (exon-intron-exon)n structure of various genes
introns can be very long, while exons are usually relatively short.
histone
total = 400 bp; exon = 400 bp
b-globin
total = 1,660 bp; exons = 990 bp
HGPRT
(HPRT)
This figure shows examples of the wide variety of gene structures seen in the human genome. Some (very few) genes do not have introns. One example is the histone genes, which encode the small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. Shown here is a histone gene that is only 400 base pairs (bp) in length and is composed of only one exon. The beta-globin gene has three exons and two introns. The hypoxanthine-guanine phosphoribosyl transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually relatively short. An extreme example of this is the factor VIII gene which has numerous exons (the blue boxes and blue vertical lines).
total = 42,830 bp; exons = 1263 bp
factor VIII
total = ~186,000 bp; exons = ~9,000 bp

15. Properties of the human genome
Nuclear genome
the haploid human genome has ~3 X 109 bp of DNA
single-copy DNA comprises ~75% of the human genome
the human genome contains ~20,000 to 25,000 genes
most genes are single-copy in the haploid genome
genes are composed of from 1 to >75 exons
genes vary in length from <100 to >2,300,000 bp
Alu sequences are present throughout the genome
Mitochondrial genome
circular genome of ~17,000 bp
contains <40 genes