Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA sequencing © 2016 Paul Billiet ODWS.

Published byBaldric Harmon Modified over 6 years ago

Similar presentations

Presentation on theme: "DNA sequencing © 2016 Paul Billiet ODWS."— Presentation transcript:

1 DNA sequencing © 2016 Paul Billiet ODWS

2 Frederick Sanger Nobel prize for chemistry (for his work on proteins) “Dideoxy” technique for DNA sequencing. © 2016 Paul Billiet ODWS

3 Dideoxyribonucleic acid
DNA uses deoxyribose To replicate DNA you need nucleotides with deoxyribose Deoxyribonucleoside triphosphates = dNTPs There are four types (dATP, dCTP, dGTP and dTTP) If a modified sugar is used replication stops Modified sugar = dideoxyribose = ddNTP ddNTPs can be made for each of the bases (ddATP, ddCTP etc). © 2016 Paul Billiet ODWS

4 Dideoxycytidine triphosphate (ddCTP)
© 2016 Paul Billiet ODWS

5 “Russian Roulette” replication
Extract DNA to be sequenced Add supplies of the four dNTPs Split sample in four tubes Add DNA polymerase and one of the ddNTPs Replication will stop after a random number of base pairs at the point where a ddNTP is inserted. © 2016 Paul Billiet ODWS

6 Gel electrophoresis ddNTP produces a test tube with a mixture of DNA molecules that are different lengths Wherever the ddNTP of that type (A, C, T or G) is inserted They can be separated by gel electrophoresis. © 2016 Paul Billiet ODWS

7 ELECTROPHORESIS The migration of electrically charged particles in colloidal solution towards the oppositely charged electrode © 2016 Paul Billiet ODWS

8 Similar to electrolysis
CATHODE - + ANODE Solution of NaCl Na+ Cl- CATION ANION © 2016 Paul Billiet ODWS

9 Gel electrophoresis of proteins and DNA
The process of electrophoresis of large molecules such as proteins and nucleic acids is carried out on gels No water currents in gels Correct buffering conditions can be carefully controlled Permits high resolution separation of very small samples. © 2016 Paul Billiet ODWS

10 DNA DNA is analysed on agarose gels which have big spaces to allow larger molecules of DNA to separate Each nucleotide on the DNA molecule carries a negative charge DNA molecules only move from the negative cathode to the positive anode. © 2016 Paul Billiet ODWS

11 DNA As the negative charge increases with size, big DNA molecules would move more quickly But bigger molecules move more slowly through the gel Gives a steady and fine separation of DNA molecules by size Molecules which differ by only one nucleotide in their length can be separated. © 2016 Paul Billiet ODWS

12 Analysis The analysis of the gel by staining, spectroscopy or autoradiography This reveals bands in the gel where the DNA fragments are located Reference molecules are run in the gel at the same time so that the molecules in the mixture can be identified. © 2016 Paul Billiet ODWS

13 Gel electrophoresis Buffer solution Agarose Gel CATHODE - + ANODE
Wells for the mixture DNA fregments separating by size Marker molecule indicates the front © 2016 Paul Billiet ODWS

14 DNA sequence Run a gel with four columns
One from each tube treated with a different type of ddNTP (A, C, T or G) The lengths of the fragments can be compared for each of ddNTPs Read from bottom to top (why?) What is your sequence? © 2016 Paul Billiet ODWS

15 Answers Bottom is the shortest so the beginning of the sequence TACGAGATATATGGCGTTAATACGATATATTGGAACTT C © 2016 Paul Billiet ODWS

16 Sequencing today Uses fluorescent dyes not autoradiography
One colour for each ddNTP Faster, cheaper, safer Automated Sequencing whole genomes becomes a reality. © 2016 Paul Billiet ODWS

17 Up to 30 bases per second

Download ppt "DNA sequencing © 2016 Paul Billiet ODWS."

Similar presentations

DNA sequencing by the Sanger method

DNA sequencing by the Sanger method
Biotechniques. Gel electrophoresis Separates molecules according to size and charge. Different sized segments of DNA cut by restriction enzymes Segments.

Biotechniques. Gel electrophoresis Separates molecules according to size and charge. Different sized segments of DNA cut by restriction enzymes Segments.
13-2 Manipulating DNA.

13-2 Manipulating DNA.
Gel Electrophoresis.

Gel Electrophoresis.
DNA Sequencing How do you do it?. DNA Sequencing DNA sequencing – used to determine the actual DNA sequence of an organism. Using a computer, one can.

DNA Sequencing How do you do it?. DNA Sequencing DNA sequencing – used to determine the actual DNA sequence of an organism. Using a computer, one can.
DNA Sequencing.

DNA Sequencing.
16.6 – Locating and Sequencing Genes. Learning Objectives Recap how DNA probes and DNA hybridisation is used to locate specific genes. Learn how the exact.

16.6 – Locating and Sequencing Genes. Learning Objectives Recap how DNA probes and DNA hybridisation is used to locate specific genes. Learn how the exact.
Sanger-Coulson Dideoxynucleotide Sequencing Kwamina Bentsi-Barnes Deisy Mendoza Jennifer Aoki Lecture 10/30/00 Best printed in color for clarity.

Sanger-Coulson Dideoxynucleotide Sequencing Kwamina Bentsi-Barnes Deisy Mendoza Jennifer Aoki Lecture 10/30/00 Best printed in color for clarity.
DNA Sequencing. * Sequencing means finding the order of nucleotides on a piece of DNA. * Nucleotide order determines amino acid order, and by extension,

DNA Sequencing. * Sequencing means finding the order of nucleotides on a piece of DNA. * Nucleotide order determines amino acid order, and by extension,
DNA Sequencing Today, laboratories routinely sequence the order of nucleotides in DNA. DNA sequencing is done to: Confirm the identity of genes isolated.

DNA Sequencing Today, laboratories routinely sequence the order of nucleotides in DNA. DNA sequencing is done to: Confirm the identity of genes isolated.
1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.

1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.
Horizontal Gel Electrophoresis for Nucleic Acids Introduction for Restriction Enzyme Digest and Polymerase Chain Reaction Labs.

Horizontal Gel Electrophoresis for Nucleic Acids Introduction for Restriction Enzyme Digest and Polymerase Chain Reaction Labs.
Gel electrophoresis Separating molecules by size and charge.

Gel electrophoresis Separating molecules by size and charge.
Electrophoresis. Means literally to “carry with electricity.” Used to separate charged molecules such as DNA, RNA, & proteins. Larger (heavier) particles.

Electrophoresis. Means literally to “carry with electricity.” Used to separate charged molecules such as DNA, RNA, & proteins. Larger (heavier) particles.
6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.
DNA sequencing: Importance Basic blueprint for life; Aesthetics. Gene and protein. –Function –Structure –Evolution Genome-based diseases- “inborn errors.

DNA sequencing: Importance Basic blueprint for life; Aesthetics. Gene and protein. –Function –Structure –Evolution Genome-based diseases- “inborn errors.
Lecture 3 Agarose Gel Electrophoresis Gel electrophoresis is a technique for the analysis of nucleic acids and proteins and preparation and analysis of.

Lecture 3 Agarose Gel Electrophoresis Gel electrophoresis is a technique for the analysis of nucleic acids and proteins and preparation and analysis of.
PCR Forensics. Today’s Lab There has been an outbreak of Salmonella poisoning in the Student Union cafeteria at Stanford University cafeteria. You have.

PCR Forensics. Today’s Lab There has been an outbreak of Salmonella poisoning in the Student Union cafeteria at Stanford University cafeteria. You have.
DNA Sequencing Scenario

DNA Sequencing Scenario
Gel Electrophoresis.

Gel Electrophoresis.

Similar presentations

Ads by Google