1. Stand alone BLAST on Linux
Sohrab Shah
Stand alone BLAST on Linux
February 18, 2004
CBW Bioinformatics Vancouver 2004
Lab 4.1
Sohrab Shah
bioinformatics.ubc.ca
Stephanie Minnema
University of Calgary
Will Hsiao
Simon Fraser University
Lab 4.1
(c) 2003 CGDN

2. Outline What is stand alone BLAST? Why stand alone BLAST?
Installing BLAST
Formatting databases for BLAST
Running stand alone BLAST searches
Changing parameters
Formatting BLAST output
Assignment
Lab 4.1

3. What is stand alone BLAST?
A local installation of the NCBI BLAST suite of programs
Requires CPU, disk and RAM
The same application that drives the NCBI WWW BLAST server
Software distribution and documentation available from:
ftp://ftp.ncbi.nih.gov/blast/executables/release
Lab 4.1

4. Why stand alone BLAST? Allows creation of custom databases
Specific data sets for specific tasks
Increase computational efficiency
Increase specificity of results
Secure querying
Important for IP protection – no internet traffic
Facilitates high-throughput analyses
No queues – only competing with internal users
Can automate searches
Lab 4.1

5. Some drawbacks Often need significant hardware resources
Need to maintain the databases
Lab 4.1

6. Installing BLAST The BLAST distribution Mailing list:
Point your browser to:
ftp://ftp.ncbi.nih.gov/blast/executables/release
Mailing list:
Distribution announcements
Bug reports/fixes
Lab 4.1

7. ftp://ftp.ncbi.nih.gov/blast/executables/release/2.2.6
We have already downloaded the distribution, but this is the ftp directory
Lab 4.1

8. Installing BLAST
Change directory to the location of the BLAST distribution
List the contents of that directory
Lab 4.1

9. Unpack the distribution
Unzip the distribution
Helpful info:
Standalone BLAST is distributed as a gzip’ed tar archive
The ‘.gz’ file extension indicates that the file has been compressed with gzip – a standard Unix compression utility
The ‘gunzip’ utility uncompresses the file
See ‘> man gunzip’ for more info
Lab 4.1

10. Unpack the distribution
Untar the distribution
Helpful info:
The ‘.tar’ extension indicates that the file is a tape archive created with tar – a standard Unix archiving tool
The tar command above extracts the archive into the current working directory
See ‘> man tar’ for more info
x = extract
p = preserve permissions
f = file
Lab 4.1

11. List the contents of the distribution
A suite of tools for
running various blast searches
formatting and extracting sequences
Documentation
README.* files – read ‘em!
Data files with scoring matrices
data
Lab 4.1

12. Configuring BLAST
We need to configure the system so the BLAST programs can function correctly
Set the PATH environment variable by editing ~/.bashrc
Save the file
Lab 4.1

13. Configuring BLAST
We need to set up a configuration file ~/.ncbirc to point to the ‘data’ directory in the distribution
Open a file:
emacs ~/.ncbirc
Save the file
Lab 4.1

14. Exit the shell Exit the shell Start a new shell
When you start a new shell, your environment will be set up to run BLAST
Lab 4.1

15. Formatting the swissprot database for BLAST
Change directory to /home/guest/blast/db
View the contents of the directory
Unzip the swissprot database
Lab 4.1

16. View the contents of the swissprot database
Lab 4.1

17. FASTA format >SOME DEFINITION OF THE SEQUENCE \n
Sohrab Shah
February 18, 2004
FASTA format
>SOME DEFINITION OF THE SEQUENCE \n
ACGATCGACTACGATCAGCAGCATAGCTACAGATAG …
What is FASTA format?
Fasta format is a very simple, but standard format to represent biological sequences in text files. It has 2 main parts to it:
a) the defline
this consists of a greater than sign ‘>’ followed by some textual description of the sequence, followed by a hard return (‘\n’)
b) the sequence string itself
this can be on one line, or can be wrapped over several lines – FASTA doesn’t care
Lab 4.1
(c) 2003 CGDN

18. FASTA -> BLASTable
FASTA formatted files are not compatible for the BLAST programs
You need to prepare the FASTA files for BLAST with formatdb
This indexes the entries in the FASTA file and enables BLAST to run much faster
Lab 4.1

19. formatdb
Formats FASTA formatted databases for BLAST
Lab 4.1

20. Formatting swissprot Format the swissprot database using formatdb
List the contents of the directory
The formatdb command will take a few minutes
Useful info:
there should be seven files that are a combination of indexes and data
note the formatdb.log file
View its contents with ‘more formatdb.log’
Ignore [WARNING] errors – potential bug in new release
You should see ‘Formatted sequences in volume 0’ as the last line in the file
Lab 4.1

21. formatdb documentation
Lab 4.1

22. Running BLAST - parameters
Program name: blastn, blastp, blastx, tblastn, tblastx
Database name: swissprot, nr, est, etc…
Query sequence file: the path to your input file
Expect value cut-off: 10, 1, 0.1, 0.001, etc…
Output file: the path to the output file
Gap open penalty
Lab 4.1

23. Running BLAST - parameters
Gap extend penalty
Nucleotide mismatch penalty
Nucleotide match reward
Number of processors for multiprocessor machines
Lab 4.1

24. Running BLAST - parameters
Substitution matrix: BLOSUM62, PAM30, PAM70,
Word size: affects sensitivity/specificity
HTML output for navigating results
Lab 4.1

25. Running BLAST - parameters
Lab 4.1

26. Running BLAST – try it Change directory to /home/guest/Lab4.1
List the contents
Useful info:
bact_genome.fna – 12Kb of genomic sequence of Pseudomonas aeruginosa for the assignment
hs_tryp_trna_synth.aa – Human tryptophanyl tRNA synthetase to try command psi-blast
test_blast.aa – test protein to try blastp and rpsblast
unknown1.aa – mystery protein for assignment
unknown2.aa – mystery protein for assignment
Lab 4.1

27. Running BLAST – try it Run the blastall command below
What will this command do?
What is the protein in test_blast.aa?
Repeat the search with a higher e-value cut-off (10) . How does the output change?
Lab 4.1

28. BLAST output
NEW
Hit list
Lab 4.1

29. BLAST output
NEW
Alignments
Lab 4.1

30. rpsblast Reverse Position Specific BLAST Query: protein sequence
Database: domains
We have installed Pfam on your laptop
Other domain databases: Smart
CDD
For creating local blastable domain databases, consult:
ftp://ftp.ncbi.nih.gov/pub/mmdb/cdd/README
Lab 4.1

31. Running rpsblast
-p flag is different than blastall
Lab 4.1

32. Run rpsblast What domains are present?
Search test_blast.aa against Pfam
Produce HTML output with ‘–T’
Open the results in your browser
What domains are present?
Lab 4.1

33. rpsblast output
NEW
Lab 4.1

34. Running psiblast Preferred option when dealing with an unknown protein
or trying to find distant homologues
Much more sensitive than blastall
Less specific with each iteration
Use blastpgp to run psiblast on the command line
Lab 4.1

35. blastpgp parameters
Lab 4.1

36. blastpgp parameters
-j: number of iterations
Lab 4.1

37. blastpgp parameters
Lab 4.1

38. blastpgp parameters -C: checkpoint for later iterations
-R: input checkpoint file
-Q: output text of matrix
Lab 4.1

39. Running psiblast (blastpgp)
Search swissprot with human tryp tRNA synthetase using psiblast with 4 iterations. Generate HTML output
How does the hit list change with each iteration?
How can the matrix.ctx file be used in downstream analysis?
Lab 4.1

40. psiblast results
Lab 4.1

41. Further information
Consult README files in BLAST distribution
Lab 4.1

42. Summary
A standalone BLAST server enables custom, secure, high throughput searches
BLAST distribution available from:
ftp://ftp.ncbi.nih.gov/blast/executables/release
Use command line parameters to ‘tune’ your searches and format your results
Use different BLAST tools for different purposes
Regular (blastall = blastp, blastn, blastx, tblastn, tblastx)
Searching for domains (rpsblast = cdd search)
distant homologues (blastpgp = psi/phi blast)
Lab 4.1

43. Assignment Four questions Running Some searches may take a few minutes
blastp: identify a protein
rpsblast: search for domains in a protein
blastx: annotate a genomic sequence
psiblast: find a function for an unknown protein
Some searches may take a few minutes
Where applicable report the e-value of hits and their locations on the query sequence and the command you used to run the search
No longer than 2 printed pages
Submit to Saara by Fri 9am
Lab 4.1