Download presentation
Presentation is loading. Please wait.
Published byIsabel Stevenson Modified over 6 years ago
1
Warm-Up (10/27) Translate this mRNA sequence:
On the piece of white paper from the back, answer the following question. Name Date Period Translate this mRNA sequence: 5' AUGAACAAUAGAUAACCGUAG 3'
2
The Central Dogma, Revisited
Nucleus DNA “transcription” cytoplasm RNA In prokaryotes, transcription is coupled to translation. “translation” Ribosome protein
3
The Central Dogma, Revisited
Nucleus DNA “transcription” In eukaryotes, RNA is post-transcriptionally processed 3’ poly-A tail added 5’ cap added Introns are excised (cut out) cytoplasm RNA “translation” Ribosome protein
4
Intron Excision Happens in the nucleus
5
Independent Practice An mRNA has the sequence:
5’ AUGGCAGGGGAUAAGAAUCGCGCAAUUU GCGGCGAAAAGCUAGGUCACACGAGUAA 3’ The red sequences are introns. Cut out the introns, then translate the processed mRNA into a protein.
6
Case Study: Lactose Intolerance
phenotype: the effect on an organism of a protein’s function. H2O + lactase gene Lactose Glucose Galactose lactase mRNA High lactase activity = lactose tolerant Low lactase activity = lactose intolerant Lactase protein (an enzyme) Lactose
7
Case Study: Lactose Intolerance
Northern European peoples began domesticating cows for milk ~7,000 years ago. Other peoples have historically relied much less on milk. Lactose
8
Independent Practice page 350 numbers 2, 3, 5, 6, 7
9
Closure (10/27) On the piece of white paper from the back, answer the following question: Name Date Period What would happen to a person if the third codon of lactase was mutated from UAU to UAG? Scale 1 – 10
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.