Presentation is loading. Please wait.

Presentation is loading. Please wait.

Warm-Up (10/27) Translate this mRNA sequence:

Similar presentations


Presentation on theme: "Warm-Up (10/27) Translate this mRNA sequence:"— Presentation transcript:

1 Warm-Up (10/27) Translate this mRNA sequence:
On the piece of white paper from the back, answer the following question. Name Date Period Translate this mRNA sequence: 5' AUGAACAAUAGAUAACCGUAG 3'

2 The Central Dogma, Revisited
Nucleus DNA “transcription” cytoplasm RNA In prokaryotes, transcription is coupled to translation. “translation” Ribosome protein

3 The Central Dogma, Revisited
Nucleus DNA “transcription” In eukaryotes, RNA is post-transcriptionally processed 3’ poly-A tail added 5’ cap added Introns are excised (cut out) cytoplasm RNA “translation” Ribosome protein

4 Intron Excision Happens in the nucleus

5 Independent Practice An mRNA has the sequence:
5’ AUGGCAGGGGAUAAGAAUCGCGCAAUUU GCGGCGAAAAGCUAGGUCACACGAGUAA 3’ The red sequences are introns. Cut out the introns, then translate the processed mRNA into a protein.

6 Case Study: Lactose Intolerance
phenotype: the effect on an organism of a protein’s function. H2O + lactase gene Lactose Glucose Galactose lactase mRNA High lactase activity = lactose tolerant Low lactase activity = lactose intolerant Lactase protein (an enzyme) Lactose

7 Case Study: Lactose Intolerance
Northern European peoples began domesticating cows for milk ~7,000 years ago. Other peoples have historically relied much less on milk. Lactose

8 Independent Practice page 350 numbers 2, 3, 5, 6, 7

9 Closure (10/27) On the piece of white paper from the back, answer the following question: Name Date Period What would happen to a person if the third codon of lactase was mutated from UAU to UAG? Scale 1 – 10


Download ppt "Warm-Up (10/27) Translate this mRNA sequence:"

Similar presentations


Ads by Google