Download presentation
Presentation is loading. Please wait.
Published byAlice Miller Modified over 6 years ago
1
DEVELOPMENT OF THE REAL-TIME RT-PCR METHOD FOR AVIAN ENCEPHALOMYELITIS VIRUS GENOME DETECTION Andreychuk D.B., Kozlov A.A., Kolotilov A.N., Chvala I.A., Irza V.N. FGBI Federal center for animal health (FGBI ARRIAH) Russia, Vladimir Corresponding author: Dmitriy Andreychuk, PhD, leading researcher of the laboratory of viral avian diseases FGBI ARRIAH, Vladimir, Russia, Cape Town 2015
2
Primers and probe for avian encephalomyelitis virus genome detection
The RT-PCR method combined with reverse transcription reaction in continuous format was developed for identification of an avian encephalomyelitis virus genome in pathological material samples. Conditions of carrying out reaction of the RT-PCR are optimized. For detection of specific amplicons in reaction the TaqMan probe with FAM was used (Table 1). Table 1 Primers and probe for avian encephalomyelitis virus genome detection Name Sequence AEVP-F 5’- CTTGTCAAG(T/G)ATAGG(T/G)TCATAGA – 3’ AEVP-R 5’- TTTTTTTTTTGAATGCTATAATC – 3’ AEVPr(R) FAM-5’- TCAAGGATAAATGAAAAATCTAAA -3’-BHQ1
3
It was established that use of a two-stage RT-PCR cycle (a denaturation at 950C, 20s and the combined stage an annealing+elongation at 570C, 40s) in this case was more perspective (Table 2). Thus reaction time was reduced, and sensitivity remained at the same level, as in classical three-stage cycle RT-PCR with a separate stage of elongation. Table 2 Сt value for testing tenfold AEV RNA dilutions with different RT-PCR variants Different PCR-RT variants Specific RNA aqueous dilutions No dil. 1:10 1:102 1:103 1:104 Three stage circle RT-PCR with different reverse transcription stage (conditions were optimized) 24,2 28,1 31,4 35,5 - Continuous RT-PCR with two stage circle (conditions were optimized) 18,5 22,6 26,8 32,2 The method was successfully tested on 12 field isolates of the virus revealed in the territory of the Russian Federation and also on known vaccine strains. High specificity of the method was shown. Analytical sensitivity of the method was 10 EID50/cm3 of the virus in suspension of a pathological material.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.