1. What is DNA and how is it Used in Forensics?

2. Vocabulary
Chromosome- A cell structure that contains genetic information along strands of DNA
DNA fingerprint- Pattern of DNA fragments obtained by examining a person’s unique sequence of DNA base pairs
Electrophoresis- A method of separating molecules, such as DNA, according to their size and electrical charge using an electric current passed through a gel containing the samples.
Gene- Segment of DNA in a chromosome that contains information used to produce a protein or an RNA molecule.
PCR- (polymerase chain reaction) a method used to rapidly make multiple copies of a specific segment of DNA from a very small amount.
Restriction Enzyme- a molecule that cuts a DNA molecule at a specific base sequence.
STR- (short tandem repeat) Repeats of short DNA sequences (2-5 base pairs) with varying numbers of repeats found among individuals.

3. What is DNA? DNA, or deoxyribonucleic acid, is the
hereditary material in humans and almost all
other organisms.
Nearly every cell in a person’s body has the same DNA.
Most DNA is located in the cell nucleus (where it is called nuclear DNA), but a small amount of DNA can also be found in the mitochondria (where it is called mitochondrial DNA or mtDNA).
The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T).
Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same in all people.

4. You Share 98.7 Percent of Your DNA With This Sex-Obsessed Ape
Bonobos and chimpanzees are the closest living relatives of humans
Bonono
Our lineage diverged from both bonobos and chimps more than 5 million years ago. The two species diverged from one another only about 2 million years ago. Accordingly, the chimpanzee and bonobo genomes are 99.6 percent identical to one another, while the bonobo and human genomes are only 98.7 percent identical. But is that enough to explain our differences with our evolutionary cousins? Enter DNA methylation. When a methyl group (CH3) binds to DNA, this can alter the expression of the gene that that specific DNA sequence represents. So, two genes, identical in sequence, can be expressed differently depending on the methyl groups bound to it.
This peaceful ape is known for forming female-dominant social groupings and resolving conflicts with sex rather than violence.

5. How do we Distinguish one Person’s DNA from another?
We do not need to sequence the entire 3 billion base pairs of a person’s DNA to distinguish it from another person’s DNA
Regions of DNA contain sequences that are bp in length that are repeated at different locations (loci) along the chromosome. CGGCTACGGCTACGGCTA (repeated 3 times at this location; at another location, it may be repeated 9 times)
These sequences are called Short Tandem Repeats (STRs) or VNTRs (Variable Number of Tandem Repeats)

6. STRs
Each person has some STRs that were inherited from mother and some from father
No person has STRs that are identical to those of either parent
The number of repeats at each loci on chromosome is highly variable in the population, ranging from 4 to 40.
Count the # of times the STR is repeated for each person below:
Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..
Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..

7. Locus or Loci:
Refers to the location on the chromosome
Allele:
For STRs,
the allele will be the number of repeats.
What is the allele for the sequence below?
CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

8. Example: Locus: D5S818 Alleles: 7,9 Paternal chromosome 5
CCAGATAGATAGATAGATAGATAGATAGATCC
Paternal chromosome 5
Maternal chromosome 5
CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

9. DNA Analysis Step 1: Specimen Collection
Biological sources include:
Blood, Saliva, Tissue, Urine, Semen, Hair, Feces, Bone, Teeth, Sweat, Skin cells
FYI
Easy to contaminate a DNA sample with DNA from other sources (bacteria, DNA of person collecting sample)
DNA is not stable for very long-it degrades
sunlight
heat
Moisture
DNA fingerprinting is a comparative process:
DNA from crime scene is compared with DNA of a suspect
So minimum of two samples must be prepared

10. DNA Collection & Comparison
DNA is found and collected at crime scenes in a variety of ways using tools such as:
Smear slides, scalpels, tweezers, scissors, sterile cloth squares, UV light, luminol, and/or blood collection kits (for sample collection of suspects or living victims

11. DNA Collection How is blood collected? Blood on Clothing
Investigators submit whole pieces of clothing or they may use a sterile cloth square and a small amount of distilled water
Dried blood on furniture
Investigators send the whole object to the lab
Dried blood on a wall, tub or some other object too big or difficult to move to the lab
Investigators scrape the blood sample into a sterile container for further analysis, or with wet cotton swab.

12. How can DNA be Used to Identify an Individual?
The uniqueness of an individual’s STRs provides the scientific marker of identity known as a DNA fingerprint.
In the United States the FBI has standardized a set of 13 STR different locations on the chromosomes for DNA typing, and has organized the CODIS database for forensic identification in criminal cases.
The United States maintains the largest DNA database in the world: The Combined DNA Index System, with over 60 million records as of 2007.

13. 13 loci used in CODIS

14. AMEL= Amelogenin = protein used to determine sex

15. STR: Short Tandem Repeat
Evaluates specific regions (loci) within nuclear DNA
FBI uses 13 standard specific STR regions for CODIS
CODIS = Combined DNA Index System
CODIS is a computer software program that operates local, State, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons.
Uses 13 DNA regions that vary from person to person
Looks for matches at more than one location on a genome for more accurate results

16. Step 3: PCR using primers targeting STRs at different loci
PCR (Polymerase Chain Reaction) allows you to make millions of copies of the STR region from a single copy of DNA you recovered from crime scene.
Since the # of times sequence is repeated is different for each person, fragment size will be different.
This is done for 13 different STR sequences at this one locus
Differences occur among individuals at each of the 13 loci on the chromosome where the STRs occur
This allows for a lot of variation

17. Step 3
If you do this for 13 different repeat sequences at 13 different loci on the chromosome, each person produces a different band pattern when the fragments are separated by gel electrophoresis

18. How is DNA analyzed? Various DNA Technologies are in use.
RFLP = Restriction fragment Length Polymorphism
PCR = Polymerase Chain Reaction
STR = Short Tandem Repeats
Mitochondrial DNA Analysis
Y-STRs

19. PCR: Polymerase Chain Reaction
Used to make millions of exact copies of DNA from a biological sample
Allows very small samples to be analyzed, such as a sample of a few skin cells
Must be very careful about contamination in this process

20. The Mystical Power of CODIS
Extremely powerful investigative tool, linking crimes, and pulling suspects out of thin air!
Can prevent, as well as solve crimes!

21. The Dark Side of CoDIS (What the FBI doesn’t want you to know.)
DNA mixtures and degraded DNA profiles have lead to spurious (fake) matches
Stringent (strict) laws explicitly permit databasing innocent people
Adding arrestees to database violates presumption of innocence
However, the prosecution rate on case to offender matches is shockingly low! (~10%)

22. Mitochondrial DNA Analysis
Used for samples that cannot be analyzed using STR
Uses DNA extracted from mitochondrion rather than nuclear DNA
Especially useful in old cases and old samples

23. Mitochondrial DNA (mtDNA)

24. Mitochondrial DNA (mtDNA)
Pros
Single-cell sensitivity because each cell contains ~1000 mitochondria
Especially useful for shed hairs, burnt remains
Can be used to establish kinship directly because entire complement of mtDNA is maternally inherited

25. Mitochondrial DNA (mtDNA)
Cons
Single-cell sensitivity because each cell contains ~1000 mitochondria = very high contamination risk!
Heteroplasmy - more than one mtDNA type manifesting in different tissues in the same individual
Lower power of discrimination - maternal relatives all share the same mtDNA

26. Y-STRs Problem: Solution: ~99% of violent crimes are committed by men
DNA Mixtures of male suspect and female victim can pose an analytical challenge, especially when the female contribution is much greater than the male = preferential amplification
Solution:
Test for markers found only on the Y-chromosome. Only male DNA is amplified!

27. Y-STRs “Khan” Argument
Lower power of discrimination - paternal relatives all share the same Y-STR haplotype
According to Family Tree DNA, Genghis Khan is believed to have belonged to Haplogroup C-M217
Genghis Khan] Mongol: (1162? – August 1227), was the founder and Great
Khan (emperor) of the Mongol Empire, which became the largest contiguous
empire in history after his demise.
He came to power by uniting many of the nomadic tribes of northeast Asia. After founding
the Mongol Empire and being proclaimed "Genghis Khan", he started the Mongol invasions
that resulted in the conquest of most of Eurasia. These campaigns were often
accompanied by wholesale massacres of the civilian populations. By the end of his life,
the Mongol Empire occupied a substantial portion of Central Asia and China.

28. DNA evidence - The Genghis Khan Effect
Scientists identified a Y-chromosomal lineage present in about 8% of the men in a large region of Asia (about 0.5% of the world total).
This pattern of variation within the lineage is consistent with a hypothesis that it originated in Mongolia about 1,000 years ago, and thus several generations prior to the birth of Genghis.
Such a spread would be too rapid to have occurred by genetic drift, and must therefore be the result of selection. The lineage is carried by likely male-line descendants of Genghis Khan and his close male relatives, and it has spread through social selection due to the power that Genghis Khan and his direct descendants held and a society which allowed one man to have many children through having multiple wives and widespread rape in conquered cities.

29. DNA Collection & Comparison
What happens after the samples are collected?
A DNA profile is created….how??
Markers are found by designing small pieces of DNA (probes) that will seek out and bind to complementary DNA sequences. This creates a distinct pattern. Again, one marker is not usually unique, but with four or five regions the match is likely
The DNA profiles are compared with samples from suspects to find possible matches.
If there are no suspects, a national database called CODIS may be used to find potential suspects.

30. Sources of DNA at Crime Scenes
Examples of sources from real cases:
Saliva on the stamp of a stalker’s threatening letter
Skin cells shed on a ligature of a strangled victim
Perspiration on a baseball cap discarded by a rapist was compared with the DNA in the saliva swabbed from a bite mark on a different rape victim
DNA analysis of a single hair (without the root) found deep in a victim’s throat
Maggots can contain DNA
of a perpetrator

31. How can DNA evidence be planted??
Sneezing or coughing over evidence
Person touches their mouth, nose or other part of the face and then touches the area that may contain the DNA to be tested.
Scene personnel can deposit hairs, fibers, or trace material from their clothing
Wind can carry in contaminants

32. Other Uses of DNA Paternity Testing and Proving Family Relations
Identification of John or Jane Does
Study of evolution and ancestry
Studying Inherited Disorders

33. Other Uses of DNA Identifying Stolen Trees, Poached Animals
Molecular geneticist Keith Woeste at Purdue University was able to prove this chunk of walnut wood came from a tree stolen in Warren County. Working in the USDA Forest Service Hardwood Tree Improvement and Regeneration Center at Purdue, Woeste ground the wood into a fine powder to extract enough DNA evidence to convince investigators the wood matched that of the stolen tree, which had been sold to a sawmill. (Purdue Agricultural Communication photo/Tom Campbell)