Presentation is loading. Please wait.

Presentation is loading. Please wait.

Comparative Genomics.

Published byMonica Cobb Modified over 6 years ago

Similar presentations

Presentation on theme: "Comparative Genomics."— Presentation transcript:

1 Comparative Genomics

2 Comparative Genomics Phylogeny Orthologs Paralogs WBG name prediction
Synteny / Conservation Multiple Alignments EnsEMBL Analysis Pipeline Compara EnsEMBL Releases Website Mirrors WormBook WormBase SAB 2010

3 (Near) Future – ABM 2008 improved ortholog relationships
paralog information add new genesets for new parasitic species unify TreeFam & Compara whole genome alignments with Haemonchus / Brugia / Pristionchus SAB 2010

4 Orthology updated TreeFam, Inparanoid and OMA
updated pipeline to use hcluster and MCoffee added paralog predictions and OMIM to WormBase SAB 2010

5 (Near) Future – ABM 2008 improved QC on ortholog relationship
paralog information add new genesets for new parasitic species unify TreeFam & Compara whole genome alignments with Haemonchus / Brugia / Pristionchus SAB 2010

6 WormBase Species (unique genes) Plant Parasites
Animal / Human Parasites Tier II Tier I Clade V Clade IV Clade III Caenorhabditae 13% 19% 31% 53% 56% C.briggsae C.brenneri C.japonica H.contortus M.hapla C.remanei C.elegans P.pacificus M.incognita M.incognita B.malayi 13% 7% 50% 55% SAB 2010

7 WBGeneName transfer modified from Tier II WBG-tool
adds pseudo-WBG names to GFF3 / Gbrowse hco-eat-4 Haemonchus contortus mha-eat-4 Meloidogyne hapla bma-eat-4 Brugia malayi SAB 2010

8 WormBase Species II (WGN-names) Plant Parasites
Animal / Human Parasites Tier II Tier I Clade V Clade IV Clade III Caenorhabditae 5340 2962 4642 807 1759 C.briggsae C.brenneri C.japonica H.contortus M.hapla C.remanei C.elegans P.pacificus M.incognita M.incognita B.malayi 5302 24191 2696 1449 SAB 2010

9 (Near) Future – ABM 2008 improved QC on ortholog relationship
paralog information add new genesets for new parasitic species unify TreeFam & Compara whole genome alignments with Haemonchus / Brugia / Pristionchus SAB 2010

10 Pecan intron loss in C.briggsae intron expansion in Pristionchus
GBrowse-SYN SAB 2010

11 EnsEMBL released C.elegans WS200 on main EnsEMBL site
released 5 Caenorhabditis on EnsEMBL-Metazoa updated codebase to r57 updated WormBase InterPro pipeline submitted bug reports & patches to ensembl-core / ensembl-compara / ensembl-hive SAB 2010

12 EnsEMBL Metazoa SAB 2010

13 Sanger WormBase Mirror
WS198 ~1600 visitors / month 8 views / visit mostly from US / UK / Canada SAB 2010

14 (Near) Future Meloidogyne incognita genes and downstream analysis
new Wormbase mirror (bigger, faster & virtualised) Tier III species on EnsEMBL-Metazoa Brugia malayi Haemonchus contortus Meloidogyne hapla Meloidogyne incognita SAB 2010

15 Acknowledgements CSHL: Sheldon McKay OICR: Todd Harris
Norie de la Cruz Abigail Cabunoc Lincoln Stein EBI: Javier Herrero Sanger: Ed Griffith CalTech: Erich Schwartz SAB 2010

Download ppt "Comparative Genomics."

Similar presentations

Mo17 shotgun project Goal: sequence Mo17 gene space with inexpensive new technologies Datasets in progress: Four-phases of 454-FLX sequencing to max of.

Mo17 shotgun project Goal: sequence Mo17 gene space with inexpensive new technologies Datasets in progress: Four-phases of 454-FLX sequencing to max of.
Distributed Annotation System Version 2 Allen Day, UCLA Anthony Cox, EBI Gregg Helt, Affymetrix Andrew Dalke, Dalke Scientific Lincoln Stein, CSHL.

Distributed Annotation System Version 2 Allen Day, UCLA Anthony Cox, EBI Gregg Helt, Affymetrix Andrew Dalke, Dalke Scientific Lincoln Stein, CSHL.
1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.

1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.
COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program.

COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program.
ABSTRACT WormBase is a freely available information resource primarily for the nematode Caenorhabditis elegans but which progressively includes data from.

ABSTRACT WormBase is a freely available information resource primarily for the nematode Caenorhabditis elegans but which progressively includes data from.
Genomic Innovations- Orthology Paralogy. Genomic innovation.

Genomic Innovations- Orthology Paralogy. Genomic innovation.
Gramene Comparative & Phylogenomics Resources for Plants Joshua C. Stein 1, William Spooner 1, Sharon Wei 1, Liya Ren 1, Doreen Ware 1,2 1 Cold Spring.

Gramene Comparative & Phylogenomics Resources for Plants Joshua C. Stein 1, William Spooner 1, Sharon Wei 1, Liya Ren 1, Doreen Ware 1,2 1 Cold Spring.
Basic Genomic Characteristic  AIM: to collect as much general information as possible about your gene: Nucleotide sequence Databases ○ NCBI GenBank ○

Basic Genomic Characteristic  AIM: to collect as much general information as possible about your gene: Nucleotide sequence Databases ○ NCBI GenBank ○
Basics of Comparative Genomics Dr G. P. S. Raghava.

Basics of Comparative Genomics Dr G. P. S. Raghava.
Comparative genomics Joachim Bargsten February 2012.

Comparative genomics Joachim Bargsten February 2012.
Anthony Rogers* WormBase Consortium *Wellcome Trust Sanger Institute California Institute of Technology Cold Spring Harbor Laboratory Washington University.

Anthony Rogers* WormBase Consortium *Wellcome Trust Sanger Institute California Institute of Technology Cold Spring Harbor Laboratory Washington University.
M ulti P aranoid Automatic Clustering of Orthologs and Inparalogs Shared by Multiple Proteomes Andrey Alexeyenko Ivica Tamas Gang Liu Erik L.L. Sonnhammer.

M ulti P aranoid Automatic Clustering of Orthologs and Inparalogs Shared by Multiple Proteomes Andrey Alexeyenko Ivica Tamas Gang Liu Erik L.L. Sonnhammer.
Finding Orthologous Groups René van der Heijden. What is this lecture about? What is ‘orthology’? Why do we study gene-ancestry/gene-trees (phylogenies)?

Finding Orthologous Groups René van der Heijden. What is this lecture about? What is ‘orthology’? Why do we study gene-ancestry/gene-trees (phylogenies)?
I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=
Finding Orthologous Groups René van der Heijden. What is this lecture about? What is ‘orthology’? Why do we study gene-ancestry/gene-trees (phylogenies)?

Finding Orthologous Groups René van der Heijden. What is this lecture about? What is ‘orthology’? Why do we study gene-ancestry/gene-trees (phylogenies)?
I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein.

WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein.
Comparative Genomics Tools in GMOD GMOD.org Dave Clements 1, Sheldon McKay 2, Ken Youns-Clark 2, Ben Faga 3, Scott Cain 4, and the GMOD Consortium 1 National.

Comparative Genomics Tools in GMOD GMOD.org Dave Clements 1, Sheldon McKay 2, Ken Youns-Clark 2, Ben Faga 3, Scott Cain 4, and the GMOD Consortium 1 National.
EBI is an Outstation of the European Molecular Biology Laboratory. Bert Overduin Daniel Rios Stephen Fitzgerald Edinburgh, 24 & 25 February 2009 Ensembl.

EBI is an Outstation of the European Molecular Biology Laboratory. Bert Overduin Daniel Rios Stephen Fitzgerald Edinburgh, 24 & 25 February 2009 Ensembl.

Similar presentations

Ads by Google