Presentation is loading. Please wait.

Presentation is loading. Please wait.

(A) SGT Antisense RNA construct

Published byGwen Golden Modified over 6 years ago

Similar presentations

Presentation on theme: "(A) SGT Antisense RNA construct"— Presentation transcript:

1 (A) SGT Antisense RNA construct
LB loxP ocspA bar 35S Napin RB SGTAS (a) (b) 100bp ladder Binary vector Varuna (host) BjSGTAS.4 BjSGTAS.81 0.9 Kb S3 Fig (A). (a) Map of the SGT Antisense RNA construct indicating the position of the primers (small black arrow) (Primer name: BjNap- F; BjSGTAS-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (899 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

2 (B) SGT RNAi construct (a) (b)
SS AS IN LB loxP ocspA bar 35S Napin RB (b) 100bp ladder Binary vector Varuna (host) BjSGTRNAi.17 BjSGTRNAi.26 0.7 Kb S3 Fig (B). (a) Map of the SGT RNAi indicating the position of the primers (small black arrow) (Primer name: Intron-F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGT RNAi transgene (732 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

3 (C) SGTamiRNA40 construct
LB loxP ocspA bar 35S Napin RB SGTamiRNA 40 (b) 100bp ladder Binary vector Varuna (host) BjSGTamiR40.3 BjSGTamiR40.35 0.7 Kb S3 Fig (C). (a) Map of the SGT amiR40 constructs indicating the position of the primers (small black arrow) (Primer name: BjNap- F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (750 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

4 (D) SCT Antisense RNA construct
LB loxP ocspA bar 35S SCTEp RB SCTAS (b) 1.0Kb ladder Binary vector Varuna (host) BjSCTAS.8 BjSCTAS.36 2.0 Kb S3 Fig (D). (a) Map of the SCT Antisense constructs indicating the position of the primers (small black arrow) (Primer name: BjSCT-EP- F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (2352 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

5 (E) SCTRNAi construct (a) (b)
LB loxP ocspA bar 35S SCTEp RB SS AS IN (b) 100bp ladder Binary vector Varuna (host) BjSCTRNAi.1 BjSCTRNAi.36 0.5 Kb S3 Fig (E). (a) Map of the SCT RNAi constructs indicating the position of the primers (small black arrow) (Primer name: BjSCTRNAi-F; BjSCT-In-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (560 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4and 5).

6 (F) SCTamiRNA 37 construct
LB loxP ocspA bar 35S SCTEp RB SCTamiRNA 37 (b) 100bp ladder Binary vector Varuna (host) BjSCTamiR37.56 1.0 Kb S3 Fig (F). (a) Map of the SCT amiR37 constructs indicating the position of the primers (small black arrow) (Primer name: BjSCT-EP- F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (1122 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

Download ppt "(A) SGT Antisense RNA construct"

Similar presentations

Fig. 4-1, p. 107. Fig. 4-2, p. 109 Fig. 4-3, p. 110.

Fig. 4-1, p Fig. 4-2, p. 109 Fig. 4-3, p. 110.
P.464. Table 13-1, p.465 Fig. 13-1, p.466 Fig. 13-2, p.467.

P.464. Table 13-1, p.465 Fig. 13-1, p.466 Fig. 13-2, p.467.
Fig. 11-1, p. 359. p. 360 Fig. 11-2, p. 361 Fig. 11-3, p. 361.

Fig. 11-1, p p. 360 Fig. 11-2, p. 361 Fig. 11-3, p. 361.
Table 6-1, p. 161. Fig. 6-1, p. 162 p. 163 Fig. 6-2, p. 164.

Table 6-1, p Fig. 6-1, p. 162 p. 163 Fig. 6-2, p. 164.
The Flavr Savr Tomato November 25, 2014 Lu Tian. Flavr Savr Tomato The first FDA approved genetically modified food Licensed in 1994 Ripening causes production.

The Flavr Savr Tomato November 25, 2014 Lu Tian. Flavr Savr Tomato The first FDA approved genetically modified food Licensed in 1994 Ripening causes production.
1 100 120 University of Oklahoma Genome Center4/14/12.

University of Oklahoma Genome Center4/14/12.
Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.
Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.

Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
1kb PpABA1 gene model AtABA1 gene model (a) (b) ATGTAA ATG TAA Fig. S1. Characterization of the PpABA1 gene. (a) AtABA1 and PpABA1 gene models. The PpABA1.

1kb PpABA1 gene model AtABA1 gene model (a) (b) ATGTAA ATG TAA Fig. S1. Characterization of the PpABA1 gene. (a) AtABA1 and PpABA1 gene models. The PpABA1.
Chapter 11: Functional genomics

Chapter 11: Functional genomics
Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.
A) EF175930 ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM208590.1 ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.
Workpackage 2: Breeding Systems

Workpackage 2: Breeding Systems
Primers to map bsd deletion points on genomic DNA NameForwardReverse Amplicon size (base pairs) A15’-CCACGGATGGAGTGAGTTCT-3’5’-GCCCCCAAGATGAGGATTAT-3’931.

Primers to map bsd deletion points on genomic DNA NameForwardReverse Amplicon size (base pairs) A15’-CCACGGATGGAGTGAGTTCT-3’5’-GCCCCCAAGATGAGGATTAT-3’931.
Fig. 6-CO, p. 184. p. 185a p. 185b p. 185c p. 185d.

Fig. 6-CO, p p. 185a p. 185b p. 185c p. 185d.
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c

a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Table A. Sequences used in making CsKASII RNAi constructs

Table A. Sequences used in making CsKASII RNAi constructs
2470 bp 1891 bp WT 1 2 3 1 2 3 4549 bp 2314 bp 1 2 3 4 A B Fig. S1. Verification with PCR amplification of the.

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.
The Flavr Savr Tomato.

The Flavr Savr Tomato.

Similar presentations

Ads by Google