Download presentation
Presentation is loading. Please wait.
1
Regulation of Cardiac aging and function by miRNAs
Reinier Boon Institute for Cardiovascular Regeneration Center for Molecular Medicine Goethe University, Frankfurt Noordwijkerhout, 15 March 2013
2
Age is the major risk factor for cardiovascular disease
(Kaystura et al., Am. J. Physiol. 1996) Cardiomyocyte Apoptosis (Lakatta, Heart Failure Rev 2002) Heart failure Cardiac fibrosis (Mewton et al., J Am Coll Cardiol 2011) (Leri et al., Circ Res 2011) Hypertrophy A role for microRNAs?
3
miRNAs play a role in cardiovascular biology
(Inui et al., Nat Rev Mol Cell Biol 2010) (Small and Olson, Nature 2011) miRNAs bind partially complimentary to target mRNAs One miRNA can have >100 target genes
4
Aged heart: Micro-Array Profiling
Total RNA miRNA mRNA Young (6 weeks) and old (18 months) C57Bl6 male mice Isolate RNA from the heart MicroRNA profiles and mRNA profiles (micro-arrays)
5
Aging induces miR-34a in the heart
miR-34a: uggcagugucuuagcugguugu miR-34b: uaggcagugucauuagcugauug miR-34c: aggcaguguaguuagcugauugc Together in a cluster Alone miR-34a expression in mouse hearts
6
MiR-34a is known to play a role in apoptosis and senescence
(Hermeking, Cell Death and Differentiation 2010)
7
MiR-34a inhibition reduces cardiomyocyte apoptosis in vitro
8
AntagomiR-34a treatment efficiently knocks down miR-34a and inhibits apoptosis in vivo
? miR-34a Cardiac miR-34 levels, 2 days after IV injection 7 days after IV injection
9
Inhibition of miR-34a in progeria mice rescues cardiac function
Ku80-/- progeria model Accelerated aging Immunosenescence Muscle weakness (Vogel H et al. PNAS 1999) * Anti-Control Anti-34a Relative expression Monitoring of heart function by echo *
10
Maintenance of cardiac function in aged miR-34a-/- mice
weeks Monitoring of heart function by echo
11
Antagomir-34a treatment improves cardiac function after acute myocardial infarction
miR-34a levels in the infarct zone miR-34a Ejection fraction Histology: Wall motion score index day0 day14
12
How does miR-34a augment cardiac apoptosis?
AMI Aging Progeria miR-34a Direct target: SIRT1, etc. Direct target: XX Direct target: XX Apoptosis Cardiac dysfunction
13
In silico predicted targets of miR-34a: PNUTS
1246 20 140 49 125 42 176 miRanda PicTar TargetScan 5.1 Only predicted target that is downregulated (<-1.5 fold) by age on the mRNA level (micro-array) (-2.0 fold) Also known as: Protein Phosphatase 1 Nuclear Targeting Subunit (PNUTS)
14
PNUTS is a direct target of miR-34a
PNUTS levels in hearts (3 weeks after i.v. injection) miR-34a PNUTS 3’UTR Luciferase AAAAAAA
15
PNUTS interacts with telomere regulator TRF2
TRF2 and PNUTS localize to DNA Damage (Bradshaw et al. Nat. Genet. 2005, Landsverk et al. EMBO Rep. 2010) PNUTS PP1 TRF2 DNA damage Telomeres PNUTS TRF2 PP1 PNUTS interacts with TRF2 at telomeres (Kim et al. Nat Struct Mol Biol. 2009) TRF2 protects telomeres from degradation and prevents apoptosis (Karlseder et al. Science 1999) p-Chk2 Apoptosis Senescence miR-34a Apoptosis PNUTS ? TRF2 loss-of-function is linked to human heart failure (Oh H et al. PNAS 2003)
16
PNUTS overexpression rescues miR-34a-induced apoptosis in cardiomyocytes in vitro
Lentiviral overexpression
17
PNUTS reduces Chk2 activation
PP1 TRF2 DNA damage Telomeres PNUTS TRF2 PP1 p-Chk2 Apoptosis Senescence
18
PNUTS induces telomere maintenance
Telomere Q-FISH PNUTS PP1 TRF2 DNA damage Telomeres PNUTS TRF2 PP1 p-Chk2 Apoptosis Senescence
19
PNUTS inhibits DNA damage
PP1 TRF2 DNA damage Telomeres PNUTS TRF2 PP1 p-Chk2 Apoptosis Senescence
20
Cardiac PNUTS overexpression preserves cardiac function after AMI
0.26 kb AAV9 with cardiac-specific promoter
21
miR-34a / PNUTS axis controls cardiac aging through regulation of telomeres and DNA damage responses
AMI Aging miR-34a PNUTS AAAAAA Other targets Telomere Dysfunction TRF2 DNA Damage Response Contractile dysfunction Apoptosis Fibrosis Hypertrophy
22
miR-34a / PNUTS axis controls cardiac aging through regulation of telomeres and DNA damage responses
23
Acknowledgements Goethe University, Frankfurt Kazuma Iekushi
Timon Seeger Susanne Heydt Franziska Gehring Natalja Reinfeld Ariane Fischer Marion Muhly-Reinholz Joachim Ehrlich Michael Potente Andreas Zeiher Stefanie Dimmeler Ludwig-Maximilians-University, Munich Stefanie Lechner Heiko Hermeking Heidelberg University Clinic Oliver Müller Hugo Katus UMRS787, Paris David Sassoon Giovanna Marazzi VU University, Amsterdam Anton Horrevoets
Similar presentations
![Telomerase, Immortalization and Cancer Eric Bankaitis Cancer Bio 169 March 9, 2006 Fig.[9]](/26/8882434/big_thumb.jpg "Telomerase, Immortalization and Cancer Eric Bankaitis Cancer Bio 169 March 9, 2006 Fig.[9]>")
