1. What do the following all have in common?
What do the following all have in common?
Plants
Mushrooms
They all use DNA as their genetic information
Bacteria
Wolves
and all other living things?
Biology students
Snakes

2. How did we find out that DNA was the genetic material?

3. Griffith’s Experiment
1928
Inject into Mouse

4. Griffith’s Experiment
Inject into Mouse

5. Griffith’s Experiment
Inject into Mouse
Mouse lives

6. Griffith’s Experiment? +
Inject into Mouse
Will not kill mouse
Will not kill mouse

7. Griffith’s Experiment+
Inject into Mouse
Mouse dies of Pnuemonia
Will not kill mouse
Will not kill mouse

8. Griffith’s Experiment
Something from the heat killed bacteria caused a change in the harmless strain of bacteria.
2. Griffith called this process Transformation.
3. Griffith concluded that some “factor” in the disease causing strain was tranferred to the harmless strain.
years later, Oswald Avery tried to find out what the “factor” was that had caused the transformation.
5. He tried proteins, fats, carbohydrates, and other molecules. He finally determined that DNA was the “factor”.
6. This was the first evidence that showed that DNA was the genetic material.

9. The Search for DNA structure
After finding out that DNA was the genetic material, the next step was to determine its structure
Chargaff showed that the amount of adenine was equal to that of thymine and the amount of guanine was equal to the amount of cytosine
Watson and Crick built the first model of DNA structure in 1953 using all of the information that had been gathered.

10. Sir Isaac Newton
"If I have seen further, it is by standing on the shoulders of giants."

11. DNA Structure
Deoxyribose Sugar

12. DNA Structure
Phosphoric Acid

13. Purines – Double Ring Nitrogen Bases
DNA Structure
Guanine (G)
Adenine (A)
Purines – Double Ring Nitrogen Bases

14. Pyrimidines – Single Ring Nitrogen Bases
DNA Structure
Thymine (T)
Cytosine (C)
Pyrimidines – Single Ring Nitrogen Bases

15. DNA Structure - Models + +
A Nucleotide

16. DNA Nucleotides (4 possible)
Thymine Nucleotide
Adenine Nucleotide
Cytosine Nucleotide
Guanine Nucleotide

17. Begins with nucleotide building blocks
DNA Structure
DNA is a double stranded molecule. The other strand is also composed of nucleotides facing the opposite direction.
Begins with nucleotide building blocks
Deoxyribose sugar
Nitrogen base
Phosphoric Acid
Adenine is always opposite Thymine
The Phosphate of one nucleotide is bonded to the Deoxyribose of the next.
Cytosine is always opposite Guanine
Guanine is always opposite Cytosine
Base Pairing: Nucleotides bases are always paired in a certain way. Thymine is always opposite Adenine.
This single strand may be millions of nucleotides long.

18. The DNA molecular is “Ladder like” in structure.
DNA “Ladder”
The DNA molecular is “Ladder like” in structure.
The uprights or sides of the ladder are composed of alternating deoxyribose sugar and phosphoric acid
phosphate
sugar
sugar
phosphate
phosphate
sugar
sugar
phosphate
phosphate
sugar
sugar
phosphate
phosphate
Every DNA molecule has the same uprights.
sugar
sugar
phosphate

19. The DNA molecular is “Ladder like” in structure.
DNA “Ladder”
The DNA molecular is “Ladder like” in structure.
The rungs or steps of the ladder are composed of the nitrogen base pairs.
It is the order of the nitrogen bases that makes DNA molecules different
A  T
T  A
G  C
C  G

20. DNA “Ladder” . Start with Original Order of bases
Change the Order of the bases
Get a new DNA molecule

21. If you know one side of the DNA molecule, you automatically know the other

22. Actual Shape of DNA Molecule
The Ladder is twisted in a double alpha helix.
A helix is a spring-like structure.
An alpha helix coils down and to the right

23. Some Interesting DNA Facts
If written out, a human genetic code, a simple list of the As, Ts, Gs and Cs, would fill the pages of 200 1,000-page New York City telephone directories.
If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide.
If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).
It would take a person typing 60 words per minute, eight hours a day, around 50 years to type the human genome.
If all three billion letters in the human genome were stacked one millimeter apart, they would reach a height 7,000 times the height of the Empire State Building.
The entire human genome requires three gigabytes of computer data storage space. (One million base pairs of sequence data equals one megabyte of storage space; the human genome has 3.2 billion base pairs.)
The vast majority of DNA in the human genome -- about 97 percent -- consists of non-genetic sequences with unknown function, sometimes called "junk DNA.“
Any two unrelated strangers anywhere on the planet share 99.9 percent of the same DNA. A miniscule fraction of the genome—about 3 million of its over 3 billion bases—accounts for the vast differences within the human race.
If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference.
Human DNA is 98 % identical to chimpanzee DNA. We share about 75% of the same DNA as a mouse.
Humans have approximately 30,000 genes. (Section of DNA that codes for a particular protein) Chimpanzees have around the same number of genes as we do.
The roundworm has 19,098 genes.
The fruit fly has 13,602 genes.
Yeast has 6,034 genes.
The microbe responsible for tuberculosis has approximately 4,000 genes.

24. CAGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAT
How Many Letters?
CAGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAT
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGA
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGC
GTACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCT
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGA
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCTGT
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGACTA
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGTT
GAGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGG
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCTAAC
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGATTAG
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGTAC
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGATGCG
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGTAC
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGTAT
Going at the pace above, it would take 694 days or 1.9 years to write the DNA sequence of one person.
It would take 3 million slides like this to record the DNA sequence of one person.

25. DNA Replication
Every time a cell divides, it needs a new set of DNA. DNA can make exact copies of itself in a process called replication
1. Start with a single DNA molecule
2. DNA molecule “unzips” between the hydrogen bonds of the nucleotide bases
3. Each strand acts as a template to attract new nucleotides and build a complimentary strand.
4. The final result is two DNA molecules with the exact same sequence as the original.
5. Each new molecule is ½ old DNA,
and ½ new DNA
Old DNA
New DNA
New DNA
Old DNA

26. DNA Replication The enzyme Helicase separates the two strands of DNA
The enzyme DNA polymerase adds the complimentary nucleotides
The final result is two identical DNA strands

27. Replication and Cell Division
DNA replication occurs in the nucleus of the cell.
Before a cell can divide, it has to replicate its DNA
Cell division
Each new cell gets an exact copy of DNA
Each new cell gets and exact copy of DNA
Before these new cells can divide, they have to replicate the DNA again

28. How Fast is Replication?
1. In human cells, the rate of replication is about 50 base pairs every second.
2. It would take the cell about 20 seconds to replicate the following section of DNA.
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGA
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCTGT
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGACTA
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGTT
GAGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGG
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCTAAC
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGATTAG
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGTAC
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGATGCG
TACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCGTAC
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGTAT
GTACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCT
AGCTGCTAGTCCTAGCGTTAACGTCTACGTTGGCATGCTCAGTCATGTAGGCTAACCTGATCTGAGC
GTACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCT
GTACTTGCATGCTAGCTAGCTGGTACTTCCAGTCAATTCGTATAGTCTGTACTATGCTCCTGTTTCCT
3. In bacteria, the rate of replication is about 500 base pairs per second.
4. It would take a bacterial cell about 2 seconds to replicate the DNA sequence above.

29. How Accurate is Replication?
1. Process is very accurate.
2. There is about 1 error in every 10,000 base pairs.
3. A change in a single base produces a mutation.
4. Mutations can be very harmful.
5. To prevent mutations, there are also enzymes that proofread the replicated DNA and make corrections.
6. The proofreading and correcting enzymes help reduce the error rate to 1 error per 1 billion nucleotide bases.
7. Certain chemicals, cigarette smoke, ultraviolet rays from the sun, and X-rays cause an increase in the error rate.