1. The is a Critical Resource for Developing and Refining Trait-Predictive DNA Tests
Cameron Peace, Daniel Edge-Garza, Terry Rowland, Paul Sandefur Department of Horticulture
Washington State University

2. Outline of Presentation
What Are DNA Tests?
Developing Trait-Predictive DNA Tests
Conversion of Marker Types
Exploiting Synteny

3. What Are DNA Tests?
“DNA tests” = locus-specific, trait-predictive DNA-based diagnostic assays of breeding relevance
Can be one marker or sets of markers, predictive for one or more traits E.g.:
Md-PG1SSR10kd
Ma-indel

4. DNA Tests Are Developed From Trait Locus Discoveries
MTL = Mendelian trait locus
QTL = quantitative trait locus

5. Trait Locus Discoveries
2005
2007
2009
2011
2013
2015

6. Trait Locus Discoveries
2017
2705
2005
2007
2009
2011
2013
2015
Fairly well understood now that MTL and QTL discoveries are not the end-point for geneticists

7. Crossing The Chasm
Converting trait loci knowledge into practical breeding requires a focus on translational genetics
QTLs & MTLs are over here
Impact on breeding is over here

8. Developing Trait-Predictive DNA Tests
1. Locate trait locus
2. Retrieve DNA sequence
3. Seek motifs of possible
polymorphism
4. Design primers
5. Obtain primers
6. Genotype test samples
7. Inspect inheritance
8. Celebrate!
using the

9. 1. Locate Trait Locus
QTL from publication – where is this in the genome?

10. 1. Locate Trait Locus
QTL from publication – where is this in the genome?

11. 1. Locate Trait Locus
QTL from publication – where is this in the genome?
2: 17,249,600 bp
2: 19,225,000 bp
2: 20,068,100 bp

12. 1. Locate Trait Locus
QTL from publication – where is this in the genome?
±100 kb of locus (CNR12 gene in this case)

13. 2. Retrieve DNA Sequence GBrowse: Download Sequence File or
Home Page: Tools > Sequence Retrieval

14. 2. Retrieve DNA Sequence ~200 kb is usually enough to work with
Download to file

15. 3. Seek Motifs of Possible Polymorphism
For heterozygous genomes with multiple overlapping contigs (e.g., apple), very useful to compare sequence of contigs at locus of interest
Compare using external tool (e.g., CLUSTALW), seek indels between sequences = actual polymorphism
Resequencing data also great for actual polymorphism
For homozygous regions or haploid genomes, next best is possible polymorphism: seek microsatellite motifs using external tool (e.g., Microsatellite Repeats Finder)

16. 3. Seek Motifs of Possible Polymorphism
CAAAATTCGAACATTTCATCCATTTCGTCATTAGGTGCGGATTGAATTAGCAACCTCTCCTCTCTCACACACTTCGCATTCTCTTTCACATTGGTAGGGTAGGGTTAGAAAGGGACCAGAATTTGGGCGGGAAAAAGCGAAATCGAAGGTTGGAATCGAACGAAATTGAAGGTTGCTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATTGAGGACGAACGCACACAGAGGGAGTTCAGAGTTGGAGATGGCAATCCATGGATGTTGCCATCACGGGTCTGCTACTGTGGGAAGGTTGCAAAAATCAGACTTCGTGGACCTCTTCACATCCAGGACGAAGATTTTATGTTTGTGCACAGGTTTAGTCCGTCTATTTGACCCACGTTGACGCTTGATTGAGGGTTATTCGAACATTTCATCCATTTCGTCATTAGGTGCGGATTGTCGTGGACCTCTTCACTCTCATTAAAAAGAAATCTAGTCCTTGTGATGCATTTTATTTTGTACCTTAATTGAAGATACTTCACATCCAGGACGAAGTGT
(GAT)21
Microsatellite motifs that are long (15-35 repeats) and ≥ tri-nucleotides are great targets for candidate SSRs – good chance of being polymorphic and distinctive alleles
Separately target ≥ 3 motifs – hoping at least one works!

17. 4. Design Primers
Develop each candidate assay by placing flanking primers
Primer3: Choose target range of amplicon lengths
Primer3: CG clamp of “2” to improve annealing
BLAST primers to ensure uniqueness

18. 5. Obtain Primers Purchase primers from your favorite vendor
Sit around chatting about the GDR

19. 6. Genotype Test Samples
Conduct PCR for each candidate assay, on set of individuals with known/expected alleles

20. 7. Inspect Inheritance
Check if segregation patterns match expectations and needs L P1 P2 1 2 3 4 5 6 7 8 9 10

21. 8. Celebrate! Done! Celebrate!
Or go back to Step 3 – design new candidate assays
1. Locate trait locus
2. Retrieve DNA sequence
3. Seek motifs of possible
polymorphism
4. Design primers
5. Obtain primers
6. Genotype test samples
7. Inspect inheritance
8. Can I celebrate yet?

22. If Primers Are from A Publication…
Use Primer3 to redesign length, include CG clamp of 2, BLAST to confirm primer uniqueness & genomic location

23. Exploiting Synteny
Candidate gene approach, Candidate locus approach
Try these when suspect gene or trait locus identified in another crop could be associated with phenotypic difference in your crop = ?

24. Exploiting Synteny Candidate gene approach, Candidate locus approach
Then onto Step 2…
1. Locate trait locus
2. Retrieve DNA sequence
3. Seek motifs of possible polymorphism

25. Exploiting Synteny “RosMAP” Candidate locus approach
common locus for sweetness
same genomic region?
Concentric circle of Rosaceae genomes. Innermost circle = putative ancestral genome

26. Conversion of Marker Types
Can follow same steps to design assay for any marker type and platform E.g. SSR  SNP-Taqman
SSR  SNP-KASP
CAPS  SSR
1. Locate trait locus
2. Retrieve DNA sequence
3. Seek desired polymorphism
4. Design primers/probes
5. Obtain primers/probes
6. Genotype test samples
7. Inspect inheritance
8. Party!

27. Further Opportunities
Easily identify polymorphisms from resequencing data of multiple cultivars
Connect together the assay-designing (or assay-converting) steps