Presentation is loading. Please wait.

Presentation is loading. Please wait.

LT- Today, I can apply concepts that I have learned about DNA and solve a crime by drawing evidence from a DNA video, informational text, and DNA fingerprints.

Similar presentations


Presentation on theme: "LT- Today, I can apply concepts that I have learned about DNA and solve a crime by drawing evidence from a DNA video, informational text, and DNA fingerprints."— Presentation transcript:

1 LT- Today, I can apply concepts that I have learned about DNA and solve a crime by drawing evidence from a DNA video, informational text, and DNA fingerprints. What are DNA fingerprints? How are DNA fingerprints made? How can DNA fingerprints be used in society?

2 Do Now- A liver cell can make enzymes that a heart cell can not make because liver cells (1) digest large, complex molecules (2) contain more DNA than heart cells (3) use different genes than the heart cells use (4) remove carbon dioxide from blood As male children get older, some begin to closely resemble their fathers and have no resemblance to their mothers. Which statement best explains this observation? (1) Several sperm fertilized the egg, so the fertilized egg contained more genes from their father. (2) More genes are inherited from the sperm cell of their father than from the egg cell of their mother, so most traits will be like those of their father. (3) More genes from their father are expressed in traits that can be seen, and more genes from their mother are expressed in traits that cannot be seen, such as blood type or enzyme function. (4) Genes from their father are stronger than genes from their mother, so the genes from their mother are not expressed.

3 DNA. It's what makes you unique
DNA. It's what makes you unique. Unless you have an identical twin, your DNA is different from that of every other person in the world. And that’s what makes DNA fingerprinting possible. Experts can use DNA fingerprints for everything from determining a biological mother or father to identifying the suspect of a crime.

4 DNA Fingerprints- the unique banding that results from a person’s unique base pairs sequence (genetic information). DNA Fingerprinting- a technique used for identification (as for forensic purposes) by extracting and identifying the base-pair pattern in an individual's DNA We all inherit unique nonsense code/junk DNA. These nonsense codes do not actually code for specific proteins, but they are what makes our DNA fingerprints so unique. Each persons DNA fingerprint is unique, but it will have a close relationship to the individual’s parents (because we inherit the nonsense codes from our parents). Identical twins have identical DNA fingerprints. But they do not have identical hand fingerprints.

5 Individual genes are of varying lengths.
How are DNA fingerprints made? A DNA sample from body tissue or fluid such as saliva, semen, blood. 1. Restriction enzymes cut the genes apart along a DNA strand at the CCGG base pairs. CC/GG ATGCGTAGCCGGTTTAAAGGGTTTCCGGATGGTTAGCTACA Individual genes are of varying lengths. Some are millions of base pairs long while some are hundreds of base pairs long and in between.

6 2. Using a process called Gel Electrophoresis, the genes are arranged in size order. Reading a DNA Fingerprint

7

8 If humans are 99.99% identical to each other genetically, why do we have DNA fingerprints that can identify exactly who we are? A persons DNA fingerprint is unique because of nonsense codes/junk DNA. Junk DNA are bases along your DNA that do not code for proteins. Each person has unique junk DNA in their genome, but they inherit this junk DNA from their parents so their DNA fingerprints will be a combination of both parents.

9


Download ppt "LT- Today, I can apply concepts that I have learned about DNA and solve a crime by drawing evidence from a DNA video, informational text, and DNA fingerprints."

Similar presentations


Ads by Google