1. Synthetic Biology
Sergio Peisajovich
Lim Lab June 2007

2. What is Synthetic Biology?
It is an emerging field of biology that aims at designing and building novel biological systems.
The final goal is to be able to design biological systems in the same way engineers design electronic or mechanical systems.

3. Why do we need it? “What I cannot create, I do not understand.”
Synthetic Biology
Why do we need it?
“What I cannot create,
I do not understand.”
- Richard Feynman

4. Cells are the ultimate Chemical Factory.
Synthetic Biology
Why do we need it?
Cells are the ultimate Chemical Factory.

5. 1- Biology is hierarchical
Synthetic Biology
Is it achievable?
1- Biology is hierarchical

6. Synthetic Biology
Is it achievable?
2- Biology is Modular

7. Synthetic Biology
Is it achievable?
Hierarchy and Modular (recurrent) organization allows biology to be understandable and synthetic biology to be possible.

8. A possible hierarchy for synthetic biology

9. Biological Components: 1-Parts
Synthetic Biology
Biological Components: 1-Parts

10. Biological Components: 2-Devices
Synthetic Biology
Biological Components: 2-Devices

11. Biological Components: 3-Systems or Modules
Synthetic Biology
Biological Components: 3-Systems or Modules

12. Biological Components: 3-Systems or Modules
Synthetic Biology
Biological Components: 3-Systems or Modules
Basu et al (2005) Nature, 434: )

13. Biological Components: 3-Systems or Modules
Synthetic Biology
Biological Components: 3-Systems or Modules

14. Biological Components: 3-Systems or Modules
Synthetic Biology
Biological Components: 3-Systems or Modules

15. Synthetic Biology as Engineering
For synthetic biology to become a form of engineering it will be necessary to achieve precision and reliability.
Factors preventing this:
1- Incomplete knowledge of biology.
2- Inherent functional overlap (parts with many -some unknown- functions, some of which are detrimental to the goal in mind.
3- Incompatibility between parts.
4- Parts functionality depends on context.
2- CI represses expression of unrelated host genes
3- LuxR interacts with CI and blocks its function
4- GFP is non-fluorescent in host

16. Synthetic Biology as Engineering
Standard Parts
Parts should not have multiple functions
(One subunit of T7 phage DNA polymerase is actually E. coli thioredoxin)
Parts should not encode multiple functions

17. Synthetic Biology as Engineering
Standard Parts
Different parts should be compatible
Parts should work in different contexts

18. Synthetic Biology as Engineering
Standard Parts
Standardized parts could be easily exchanged between different devices (as well as between different laboratories)

19. Synthetic Biology as Engineering
Abstraction
Systems
Devices
Parts
DNA TGCATGCTGATATACGGCTCGAT

20. Synthetic Biology