Presentation is loading. Please wait.

Presentation is loading. Please wait.

The evolution of lactose tolerance

Similar presentations


Presentation on theme: "The evolution of lactose tolerance"— Presentation transcript:

1 The evolution of lactose tolerance
09 December 2005 Volvox meeting Sean Myles Max Planck Institute for Evolutionary Anthropology Leipzig, Germany

2 Lactose Glucose + Galactose
Lactose = complex sugar Lactase = digestive enzyme Lactose Glucose + Galactose Lactase

3 Some humans are strange!
All mammals and most humans stop producing lactase after weaning Lactose tolerance = lactase persistence Simple dominant mode of inheritance Human genetic polymorphism Where is the mutation?

4 Genetic association study
Step 1: Identify a candidate gene Step 2: Find a mutation in the candidate gene that associates with the trait of interest AGCTTGCTATCGGTAAGCTTAGCTTAGCT Lactose intolerant people AGCTTGCTATTGGTAAGCTTAGCTTAGCT Lactose tolerant people

5 The Lactase Gene = exon C-13910T
LCT MCM6 = exon C-13910T 100% association with lactose tolerance lies in a transcription factor binding site

6 Lactose tolerance frequencies in the Old World
Sweden 99% Germany 80% Greece 47% Japan 15% Bedouin 85% China ~10% Beja 87% Frequency of lactose tolerance Tuareg 87% 30% 30-60%  60% Tussi 93% Fulani 78% South Africa 5%

7 Natural Selection Traits that have been driven up in frequency
“Variations, however slight and from whatever cause proceeding, if they be in any degree profitable to the individuals of a species […] will tend to the preservation of such individuals, and will generally be inherited by the offspring. The offspring, also, will thus have a better chance of surviving, for, of the many individuals of any species which are periodically born, but a small number can survive. I have called this principle, by which each slight variation, if useful, is preserved, by the term natural selection.” (Charles Darwin in The Origin, 1859) Traits that have been driven up in frequency by natural selection are called adaptations.

8 The culture-historical hypothesis
Simoons (1965) Cultures that relied on milk as a nutritional source experienced natural selection for lactose tolerance Gene-culture coevolution Humans co-directed their own biological evolution by creating the selection pressure for lactose tolerance

9 Gene-Culture Coevolution
Cultural mediation of selection pressures Gene pool t Et Culture Development Natural Selection Cultural inheritance Genetic inheritance Time Gene pool Et+1 t + 1 Culture Natural Selection Development

10 Detecting the signature of selection from genetic data
AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGGTTAGCT AGCTTGCTATCGGTATGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTATGCTTAGCTTAGCT SNP = single nucleotide polymorphisms Occurrence 1 in 1000 nucleotides Main source of human genetic variation

11 Genome-wide SNP data HapMap project
approx. 3 million SNPs in 4 human populations project will be extended Perlegen data approx. 1.5 million SNPs in 3 human populations Populations include: African-Americans European-Americans Chinese-Americans

12 Fst – genetic differentiation
a measure of frequency difference between populations Population A Population B Pop A = 20% Pop B = 30% = T allele = C allele Pop B = 80% Little population differentiation Low Fst Lots of population differentiation High Fst

13 African-Americans vs. European Americans
Fst distribution for 1.5 million SNPs # of SNPs within and around the lactase gene = 100 # of top 1% Fst SNPs within lactase gene = 15 top 1% Fst = 0.5

14 Evidence for selection?
How unusual does the lactase gene look? How often are 15 out of 100 SNPs within the top 1% of the Fst distribution in the whole data set? Sample 10,000 times from data at random blocks of 100 SNPs and count # of top 1% SNPs in each iteration Observed = 15, p = 0.016

15 Frequency of lactose tolerance Expected frequency of lactose tolerance
What about African dairying populations? . Ga’ali (.53) (0) Wolof (.51) (0) Shaigi (.38) (0) Nuer (.22) (0) Dinka (.26) (0) Evidence for convergent evolution?? Red Frequency of lactose tolerance Blue Expected frequency of lactose tolerance from frequency of T

16 Lessons from Lactase Lactose tolerance is rare worldwide and is found at high frequencies only in dairying populations Genetic signature of selection: the lactase gene in Europeans possesses one of the strongest signatures of selection to be detected in the human genome Gene-culture coevolution: culture can drive biological evolution in humans Convergent evolution: lactose tolerance may be an example of recent convergent evolution in humans


Download ppt "The evolution of lactose tolerance"

Similar presentations


Ads by Google