1. Ion Torrent: Open, Accessible, Enabling
Mike Lelivelt, Ph.D., Director of Bioinformatics
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

2. Why Ion Torrent loves Galaxy?
How genomics software works…
Algos get wrapped into workflows that kick out pretty pictures. User turns knob. Create subset. Repeat.
Genomics will impact diagnostic medicine.
But there’s a whole lot more discovery to undertake.
The future of genomics in medicine is dependent on Galaxy.
Confidential and Proprietary—DO NOT DUPLICATE

3. Galaxy Development Challenge
Build a Galaxy transfer plug-in. Win 500 points on Ion Community (good towards an iPad), plus a iPod Nano.
Gain the admiration of your Galaxy colleagues.
Plus we’ll give another iPad away at the end of this talk.
Confidential and Proprietary—DO NOT DUPLICATE

4. Simple Natural Chemistry
Eliminate source error:
Modified bases
Fluorescent bases
Laser detection
Eliminate read length limitations:
Unnatural bases
Protect/de-protect
Slow cycle time H+
Sequence is determined by measuring hydrogen ions released (1 per base added per DNA strand) during 2nd strand synthesis when complementary base (A, C, G or T) are sequentially incorporated by DNA polymerase.

5. Transformative Technology
Scalable Semiconductor Technology Plus Simple Chemistry
The chip that see chemistry
Read clockwise from Wafer.
Ion Torrent chip manufacturing process leverages the cumulative investment in semiconductor manufacturing over the last 30 years. Chips are produced in std semiconductor factories (a.k.a. foundries) and are similar in design to CMOS image sensor chips found in iPhones and Blackberry’s. Wheras the image sensors collect photons. Ion Torrent chips collect Protons
Cross sectional view shows the Ion sensitive layer in green with the microwells on the top surface (3um) with the transistor stack underneath

6. Torrent Browser runs on Torrent Server
Local compute and storage with an integrated web interface
Torrent Server – hardware appliance
Torrent Browser – easy web access to Ion data
Plugins for secondary analysis e.g. variant calling
For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.

7. Data Flows Directly to Ion Reporter Torrent Circuit and Desktop Solutions also Enable Other Research Applications
Ion Reporter to support variant calling and annotation of tumor-normal pairs and mother-father-offspring trios
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

8. Torrent Suite Data Analysis Flow
Incorporation for
1 Flow (DAT)
Incorporation over
many flows (DAT)
Raw signals per flow (WELLS)
Processed
incorporations (SFF)
Flow space converted to base space (FASTQ)
@7D8NM:4:9
GGGATCAGGCTGTCGAACGCGTGATTACATCTAGCTA +
BAM
Variant Call Format (VCF)
##FORMAT=<ID=DP,Number=1
##FORMAT=<ID=HQ,Number=2
#CHROM POS ID REF ALT QUAL FILTER
rs G A PASS
binary 8 8

9. Proton Data Processing On/Off Instrument

10. Torrent pipeline – Approx. data sizes*
Process Description File Type chip chip chip
Raw Voltage Data
DAT
40 GB
180 GB
320 GB
Signal Processing
WELLS
1 GB
8 GB
12 GB
Base Calls - Flow
SSF
1 GB
5 GB
8 GB
Base Calls - Base
FASTQ
0.3 GB
1.5 GB
2 GB
Base Calls - Aligned
BAM
0.1 GB
0.6 GB
3.5 GB
*1.5 v run 200bp runs (440 flows, 110 cycles), Nov 2011 10

11. Proton pipeline – Approx. data sizes*
Process Description File Type Proton I chip* Proton II chip*
Signal Processing
WELLS
180 GB
720 GB
Base Calls - Flow
SFF
120 GB
480 GB
Base Calls - Base
FASTQ
30 GB
120 GB
Base Calls - Aligned
BAM
53 GB
210 GB
Note: Files are in “native” format

12. Proton™ Torrent Server Specifications
A single, free-standing tower computer appliance that includes Torrent Suite Software v3.0 for signal processing, base calling, alignment, and variant calling
Stores >50 Ion Proton™ I Chip runs
8.5 in/21.8 cm
~120 lb/55 kg
26 in/64.6 cm
17 in/43 cm
Processors
Dual 8-core 2.9 GHz CPUs 128 GB RAM 2x NVIDIA® Tesla® GPUs 27 TB Ubuntu® 10.04
Memory
GPUs
1 Torrent Server per Proton required (1:1 configuration)
Storage OS
The content provided herein may relate to products that have not been officially released and is subject to change without notice. 12

13. Efficient data processing on Torrent Server4X
faster
Processing times for Proton 1 chips will be hours, not days.
Over the last nine months of software improvements, many enhancements in both signal processing and base calling have lead to faster and faster processing times. This graph illustrates the rapidly decreasing run times for a single 318 chip from the PGM system being processed on the Torrent Server (Dell T7500). As we look forward to processing times on the Proton, these speed improvements coupled with more powerful processing hardware on both the Proton itself as well as a beefier Proton Torrent Server will mean that a Proton chip will be processed in hours rather than days.

14. Torrent Suite Virtual Machine
Virtual machines are available for use in development
Penguin Computing:
Amazon AMI: search “ion-torrent” or AMI-2c64c745
Download to run locally

15. Torrent Suite SDK Plugins are driven by shell scripts and html pages
API
Plugins / Publishers
Plugin Store
Plugins are driven by shell scripts and html pages
#!/bin/bash
OUTFILE=${RESULTS_DIR}/${PLUGINNAME}.html
echo "<html><body>Hello World!</body></html>" > $OUTFILE
launch.sh

16. Ion Community Learn, Collaborate, Contribute Ion Community
Run RecognitION
Torrent Browser
Plugin Store
Over 11,00 members
Over 100 new members each week
Source code
Datasets
Rank your runs against other users
Win free chips for monthly best run
Win $5k for new records
Share your plugins with the community and earn points towards prizes
Over 25 plugins currently available for FREE
For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.

17. Ion PGM™ Performance Update

18. Accuracy A track record of continuous improvement
Dec 2010: Ion Sequencing 314 Kit, PN
Jul 2011: Ion Sequencing Kit, PN
Jan 2012: Ion PGM™ 200 Sequencing Kit, PN
May 2012:
300bp:
400bp:
Nothing Gets Better Faster

19. High Data Quality May 2012 launch 4.6Mb EHEC E. coli
This is a shotgun library reaction of the German EHEC E. coli outbreak strain using the Ion Xpress Plus library kit.
Coverage
~250X
Most Common Read Length
255 bp
Mean Raw Accuracy (1X)
99.6%

20. AmpliSeq™ Highly Consistent Results
A summary of seven validation runs performed in early June 2012.
Comprehensive Cancer Panel
Standard DNA (N=4)
FFPE DNA (N=3)
Coverage Uniformity
93.72 ± 0.16%
93.4 ± 1.3%
On Target Reads
94.30 ± 0.63%
95.4 ± 5.5%
Raw Accuracy
99.42 ± 0.08%
98.8 ± 0.8%
Depth of Coverage
± 64.51x
342 ± 92x
This is a summary of seven run including both FFPE and standard DNA that were performed during the final validation of the new chemistry illustrating consistent results. Values show represent means and standard deviations.
Coverage Uniformity—bases covered at 20% of the mean coverage
On-target bases (Specificity) - Bases that mapped to target regions out of total bases per run
Depth of Coverage – Average coverage over target region from a single 318™ Chip

21. Accurate 300 base Reads – Q3 2012 Most Common Read Length 300 bp
We have also released data representing forward looking sequencing chemistry. In Q3 2012, we’ll be releasing kits that provide 300 bp read lengths. This run is currently publicly available on ion community.
Run Name = B7-143
Most Common Read Length
300 bp
Mean Raw Accuracy (1X)
99.7%

22. Accurate 400 base Reads – Q4 2012 % Q30 bases @ 400 bp 65%
A second forward-looking run was just released demonstrating 400 bp read lengths with mean per base accuracy of 99.5% across the legnth of the read.
% Q bp
65%
Most Common Read Length
398 bp
Mean Raw Accuracy (1X)
99.5%

23. Homopolymer Performance Indel and homopolymer accuracy has improved ~450% since July 2011
Indels
per 100 bp
July 2011 Kits (Loman et al )
1.44
May 2012 Kits
0.32
Homopolymer Accuracy
Methods Indels per 100 bp
Table1 – Indels per 100bp. FASTQ files for Ion Torrent (1) run in the Nature Biotechnology paper were mapped with bwa using the same parameters as Loman et al and the indels_per_100 stat in Supplementary Table1 was calculated using the same script referenced in the publication ( as well as the same reference
For HP accuracy:
BAM files were parsed using a C++ program alignStats, available as a binary in Torrent Suite, with the following parameters:
alignStats -i <bam_file> -p 1
The resulting Default.sam.parsed files were used for  homopolymer accuracy calculations. Accuracy is defined as 1 minus the total number of errors divided by numbers of bases and plotted against homopolymer length.
Homopolymer Length
Indels per 100bp. FASTQ files for Ion Torrent (1) run in the Nature Biotechnology paper were mapped with bwa using the same parameters as Loman et al and the indels_per_100 stat in Supplementary Table1 was calculated using the same script referenced in the publication ( as well as the same reference
Trimming and Filtering: Read filtering was done using a sliding window of size 10 moving from 5' to 3'. When the average QV of the window dropped below 15, the 3' end of the read was clipped.
HP accuracy: BAM files were parsed using a C++ program alignStats, available as a binary in Torrent Suite, with the following parameters: alignStats -i <bam_file> -p 1
The resulting Default.sam.parsed files were used for  homopolymer accuracy calculations. Accuracy is defined as 1 minus the total number of errors divided by numbers of bases and plotted against homopolymer length.

24. Improving Homopolymer Calling
NA12878 Sample Runs
KER_919
FLO_530
FLO_550
Total number of HP Variant (size > 3) Annotated in CCP 409 Panel = 14.
Total positions analyzed: ~21000 homopolymer positions of length greater than or equal to 3 were analyzed using the model.
Sample TP FN FP
KER_919 13 1 3
FLO_530
FLO_550 4
Confidential and Proprietary—DO NOT DUPLICATE

25. Detect 5% SNP in Ion AmpliSeq™ Cancer Panel
Detected rare 5% variants in Ion AmpliSeq™ Cancer Panel
90:10 mix of two known DNA samples (NA12878:NA19240)
Average coverage 1500x
Sensitivity – 83%
detecting 5 out of 6 true positives at 5% frequency
Consensus Accuracy %
Detect rare 5% SNP in a heterogeneous population

26. Ion Proton™ System Overview

27. Ion Semiconductor Sequencing Unprecedented Scalability Since 2011
100 Gb
10 Gb
1 Gb
100 Mb
100X demonstrated in the 1st year, About 100X in the 2nd year
Illumina has shown zero scalability (600Gb in 2011, 600Gb in Their SBS optical technology has Plateaued)
10 Mb
2011
2012
2013
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

28. $500 Exome and $1,000 Genome Sequencing in as little as 2 hours on the Benchtop
Ion Proton™ I Chip
Ion Proton™ II Chip
2 human exomes Up to 10 Gb 165 million wells Up to 200bp reads 2-4 hour runs $1,000 per run
1 human genome
Up to 20X
660 million wells
Up to 200bp reads
2-4 hour runs
$1,000 per run
The Ion Proton I and II Chips will enable the $500 and $1000 exome and genome, respectively – all sequenced in a few hours on the benchtop
On the left is the Ion Proton I Chip, which generates enough sequence for 2 human exomes from 165 million total wells for $1000 per run (template and sequencing kits/chips only)
On the right is the Ion Proton II Chip, which generates enough sequence for 1 human genome from 665 million total wells for $1000 per run (again, template and sequencing kits/chips only)
Combined, these chips will be the highest throughput (Gb per hour/day) platform on the market when they’re available
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

29. Harnessing a Decade of Moore’s Law in One Leap…
So how are we able scale the technology, so dramatically? Simply put, we’re taking advantage of decades of accumulated Moore’s law and increasing the density of the number of wells in the Proton chip without substantially increasing the size of the chip (165M wells in the proton chip vs. 1.3M wells with 314 Chip)
More wells – more sequence
Key differences with the Proton I chip vs. 3-series chip:
Larger surface area (1.25” chip vs. 1” chip)
Smaller wells (1.3u vs. 3u)
More wells (165M vs. 1.3M)
2 transistors per well vs. 3 transistors to enable more transistors to be packed together
Analog to Digital conversion on chip
Nature 475, 348–352 (21 July 2011)
Ion Proton™ I Chip: 165 million wells (>100-fold more wells than Ion 314™ Chip)
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

30. …While Seamlessly Scaling Ion’s PostLight™ Sequencing Chemistry…
Ion 314™ Chip Signal
Ion Proton™ I Chip Signal
Nucleotide Incorporation Signal
In addition, we’ve seamlessly scaled our sequencing chemistry to attain the same amount of signal produced in each well and the same nucleotide incorporation times as the 314 chip.
So, in an aggregate basis, we expect to generate the same type of data as the 314 in similar timeframes (i.e., hours per sequencing run)
Same Signal, Same Speed
Proton Pre-Release Data Not Final Commercial
Performance
Internally generated R&D data shown
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

31. …Resulting in the Rapid Development of the Ion Proton™ System over the Past 6 Months
Millions of Mappable Reads per Run (≥50bp)
Mappable Bases per Run (Gb)
These graphs show our record run improvements that we’ve achieved internally over the past 6 months. As you can see, the Proton I chip has been quickly brought up over the past 6 months and we are on track to deliver on our commercial launch spec of up to 10 Gb
For these graphs, mappable means >Q17
Proton Pre-Release Data Not Final Commercial
Performance
Internally generated R&D data shown
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

32. Ion Proton™ System The Benchtop Genome Center
Runs Ion Proton™ I and II Chips
Benchtop system containing state-of-the-art electronics to support the highest throughput
Dual 8-core Intel® Xeon® Sandy Bridge processors
128 GB of RAM
Altera® Stratix V FPGA
NVIDIA GPU
11 TB of hybrid (SSD&HDD) storage
Ubuntu® 11.1 operating system
List price: $224K system (USD, sequencer & server)
The benchtop genome center:
Supports Ion Proton I and Proton II chips - (no paid upgrade needed)
$224K System List Price (USD)
For PGM owners, SOLiD owners, and HiSeq owners we have a friends and family promotion of $174K
State-of-the-art electronics to support Proton’s industry leading throughput including the latest high capacity solid state drives (SSDs), latest dual socket Intel motherboard and processors, and additional computing power to really drive as much of the analysis of the raw chip signals on the Proton as possible. As a result, we only require a desktop server to support FASTA/FASTQ file generation, alignment and variant calling activities.
Updated electronics will be necessary to support the much higher level throughput obtained with the Proton Chips. We’ve nearly jumped a decade of Moore’s law, and the electronics have to be updated to keep up with the what we expect will be the highest throughput platform around. Relative to PGM, the Proton has several key differences in its electronics including:
Dual 8-core Intel Xeon Sandy Bridge processors
64 GB of RAM
FPGA additional compute
Nvidia GPU
15 TB of additional storage balanced between SSDs and larger SATA drives
Regardless, we think this is still a tremendous value for customers given not only the discount pricing, but that typical systems with similar throughput capabilities are on the order of several hundreds of thousands of dollars. We truly are trying to enable broad access to high throughput sequencing with Ion’s technology!
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

33. Confidential and Proprietary—DO NOT DUPLICATE
Hardware Differences
PGM
Proton
Instrument:
AD on Instrument
Low Compute PPC
Reader Board:
Older generation FPGAs
No HW Accelleration for Analysis
Torrent Server
Supports up to 2 PGMs
12 Intel Cores
1 Nvidia C2050 GPU
48 G Memory
Instrument:
AD on Ion Chip
Dual Socket Xeon Server
Reader Board:
Latest Stratix V FPGAs
NVidia GPU Acceleration
Torrent Server
Supports Single Proton
16 Intel Cores
2 NVidia C2075 GPUs
128 G Memory
Confidential and Proprietary—DO NOT DUPLICATE

34. Proton™ Torrent Server
Single Day Workflow…
We will be able to achieve the highest throughput without compromising the speed of platform. The workflow for the Proton I and II chips will still be completed in a single day
A New version of OneTouch System will be required for Proton
A cloud option (Ion Reporter) will also be available for both Proton and PGM to manage, annotate, and archive variants of interest for future interpretation
Ion Library Kits
2 Hours (Fragment)
Ion OneTouch™ 2 System
4-6 Hours
Ion Proton™ Sequencer
2-4 Hours
Proton™ Torrent Server
<12 Hours
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

35. …With the Fastest Sequencing Run Times
Sequencer Throughput Comparison (Gb per hr)
Exome and genome sequencing in hours
Proton I throughput comparable to industry standard
Proton II will be ~3X faster than projected improvements to other platforms
Proton II 10 Gb/hr
Gb/hr
We’ll be able to start generating quotes in the January time frame
Early access to commence in mid-2012 and is fully subscribed at this time and not relevant to the sales team. At the same time, we will commence shipment of the Ion Proton chip to the early access sites, with the Proton II chip to be available 6 months later.
In Late Q3:2012, we will ship and install any remaining 4-unit orders in a restricted release program
By the end of Q3:2012, we expect to commence the unrestricted release of the Ion Proton System with a target to install these units in Q4:2012
Firmer/more specific dates to be provided as we get closer to launch
Proton I 2.5 Gb/hr
Gb/hr
Gb/hr
2X Gb/hr
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

36. Exome Workflow and Data on the Ion Proton™ System

37. Ion Proton™ System Exome Workflow A Complete, End-to-End Exome Solution
Ion TargetSeq™ Exome Kit
Ion OneTouch™ 2 Instrument and Ion OneTouch™ ES
Ion Proton™ Sequencer
Proton™ Torrent Server and Ion Reporter™ Software
We will be able to achieve the highest throughput without compromising the speed of platform. The workflow for the Proton I and II chips will still be completed in a single day
A New version of OneTouch System will be required for Proton
A cloud option (Ion Reporter) will also be available for both Proton and PGM to manage, annotate, and archive variants of interest for future interpretation
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

38. TargetSeq™ Enrichment Uses a Simple Probe Capture Workflow
1) Mix library with capture probe pool & blockers
2) Hybridize probe to targeted libraries
Library
Capture Probes
4) Amplify captured libraries off beads (enriched Targets)
3) Pull out hybridized targets with Dynal™ beads
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

39. Ion TargetSeq™ Exome Kit with Ion Proton™ Sequencing Yields High Quality Exomes…
Chip Loading
Count
Percentage
Total Addressable Wells
164,822,784
Wells with ISPs
139,574,799
85%
Live ISPs
135,946,926
97%
Test Fragment ISPs
39,283
<1%
Library ISPs
135,907,643
100%
Throughput (Gb)
Mappable
Perfect
Total Number of Bases
7.0 Gb
5.2 Gb
Throughput (Reads)
Mappable
Perfect
# of Reads ≥50 bp
99,615,132
49,126,825
# of Reads ≥100 bp
88,236,276
21,837,494
# of Reads ≥150 bp
584,960
2,654
Modal (most common) Read Length:125 bp
NA12878 sample pulled down with new 50 Mb TargetSeq design (to be made available with Proton launch)
We have an enrichment and chip loading technique that maximizes well-filling with template positive IonSphere Particles (85% and >95%, respectively).
Given this, our focus between now and commercial launch is to increase the modal read length and quality of reads to get total mapped bases of up to 10 Gb (our commercial launch spec)
As a technology that can generate ~50M perfect reads bp), this is also an ideal technology for rapid transcriptome analysis
Data Quality
Avg. Raw Read
@ 100 bp
Accuracy
99%
Proton Pre-Release Data Not Final Commercial
Performance
Internally generated R&D data shown
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

40. …with Excellent Coverage Uniformity and SNP Concordance
95X average depth
90% of bases at ≥ 20X
Excellent coverage uniformity with 90% of bases covered at >20X
High SNP concordance with 98% of the SNPs identified found in dbSNP135
Good on-target rate: 76.6% on-target rate
Benchmark references (From Clark/Snyder paper in Nature Biotech, October 2011)
HiSeq+Illumina TruSeq Exome – 90.0% of bases covered at ≥ 10X depth of coverage, 75% of bases covered at ≥ 20X depth of coverage, 99.2% SNP concordance, 64.4% on-target rate
HiSeq+Agilent SureSelect – 89.6% of bases covered at ≥ 10X depth of coverage, 75% of bases covered at ≥ 20X depth of coverage, 99.3% SNP concordance, 87.2% on-target rate
# called SNPs
% SNPs in dbSNP135
# called Hets
% Hets in dbSNP135
# called Homs
% Homs in dbSNP135
29,598
98.0%
17,579
97.2%
12,019
99.3%
Proton Pre-Release Data Not Final Commercial
Performance
Internally generated R&D data shown
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

41. Transcriptome Workflow on the Ion Proton™ System

42. Transcriptome Workflow on the Ion Proton™ A Rapid, End-to-End Transcriptome Solution
Ion Total RNA-Seq Kit v2 and RiboMinus™ Eukaryote Kit v2
(6 hours)
Ion OneTouch™ 2 Instrument and Ion OneTouch™ ES
(4-6 hours)
Ion Proton™ Sequencer
(2-4 hours)
Proton™ Torrent Server and 3rd Party Software
(Overnight)
We will be able to achieve the highest throughput without compromising the speed of platform. The workflow for the Proton I and II chips will still be completed in a single day
A New version of OneTouch System will be required for Proton
A cloud option (Ion Reporter) will also be available for both Proton and PGM to manage, annotate, and archive variants of interest for future interpretation
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

43. Whole Transcriptome Library Solution Ion Total RNA-Seq Kit + RiboMinus™ Eukaryote Kit v2
Ion Total RNA-Seq Kit v2
Creates whole transcriptome (WT) libraries
Maintains strand orientation
Minimizes bias and error
Fast, simple, workflow (no gel purification)
Low sample input requirements: 100ng of total RNA or 1-500ng of mRNA
RiboMinus™ Eukaryote Kit v2
Improved probe design targeting multiple rRNA types
<10% mapping to cytoplasmic and mtRNA
1h workflow (optional mag bead purification)
Low and standard input kits: 10ng-1µg for low; 1-5µg for standard input
Comparable pricing to current RiboMinus kits
Additional Total RNA-Seq Notes
Workflow is also automation compatible
Adaptor and RT primer sequences specific for Proton sequencing enable low inputs requirements
Additional RiboMinus Notes
Multiple probes targeting 28S, 18S, 5.8S & 5S cytoplasmic rRNA and 16S & 12S mitochondrial rRNA

44. More Information is Available
Learn more about how to analyze Ion RNA-Seq Data
White paper is available on the Ion Community that explains more details on processing Ion RNA-seq data
I am going to spend a few minutes and talk about the data analysis aspects of RNA-seq on the Ion Torrent platform. If you miss something or want more information, I wanted to make you aware that we have a white paper that is available on the Ion Community that will go into a lot more depth.
lifetechnologies.com/ioncommunity

45. QA/QC for ERCC ERCC_Analysis
Quickly generate a QA / QC plot for samples using ERCC spike-ins
ERCC_Analysis
Dose response plot for any run using ERCC
For example, we have provide a plugin that will allow you to identify and quantify ERCC spike-ins and do the QA/QC for those spike-ins. This is allows you do asses the quality of a run prior to moving forward with your in depth analysis. This plugin is freely available on the Torrent Browser Plugin Store on the Ion Community

46. Ion RNA-Seq Data Analysis Workflow
Leverages tools and software already familiar to microarray users A
Data Generated
on Ion Proton™
Sequencer
Microarray User-Friendly Analysis tools:
Partek® and GeneSpring® based tools
Full compatibility with NGS and microarray data
Both tools take FASTQ files from PGM, align the sequences and provide an extensive set of options for data visualization, statistical tools and annotation tools
Comprehensive data analysis tools to reduce your time to publication B
Base Calls
On the Proton™
Torrent Server C
Quality Assessment
On Torrent Server
ERCC plug-ins D
End to end RNA-seq data analysis provided by Partek-Flow and Avadis NGS

47. Thanks – Let’s eat & drink. Repeat.

48. Confidential and Proprietary—DO NOT DUPLICATE
Just one more thing…
Right now, let’s give away an iPad 2.
Right here.
Right now.
Then we drink.
Confidential and Proprietary—DO NOT DUPLICATE

49. Confidential and Proprietary—DO NOT DUPLICATE
All products mentioned in this presentation are for Research Use Only, not intended for any animal or human therapeutic or diagnostic use.
Confidential and Proprietary—DO NOT DUPLICATE