2. 16 S ribosomal DNA
TGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTTGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCCCTTGAACGCCGTAAACGATGTCGGCGTGGCTTCCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCACTTGGAGGTTGTGCTCCGCACAAGCGGTGGAGCATGT

3. Dna fragment on agarose gel electrophoresis
For found gene
DNA fragment –large fragment
_middle fragment
_ small fragment
Migrate DNA depend on length
Migrate protein depend on weight
Base pare stander

4. Dna fragment on agarose gel electrophoresis

5. DNA migrate from cathode(-) to anode(+)

6. Restriction enzymes

7. Restriction enzymes Restriction enzymes
Restriction enzymes
Cut specific sequence of DNA restriction enzymes two type
Classic coloning
Cut specific fragment of DNA with the same restriction enzyme.
Legate them with each other by ligase enzyme
Introduce vector on bacterial/yest cell by transformation
Expressing the cloned gene (DNA fragment)
PCR coloring
Multiply a certain sequence of DNA on PCR

8. Classic coloning

9. There is about 3500 type of restriction enzymes that cut a specific sequence on DNA, each specific has its own restriction enzyme 1-Recognize site of restriction 2-Attach to site 3-Start its cat

10. Restriction enzymes cut specific sequences of nucleotides forming cohesive(sticky end), that are easily to relegate (sealed) than blunt ends.

11. Type of cut gene by restriction enzyme
sticky (cohesively)
Less fragment
More get gene
Even
blunted
More fragment
Less optain required gene
Not cohesively

12. some restriction enzyme as sticky end and blunt end

13. some restriction enzyme as sticky end and blunt end

15. How to isolation restriction enzyme??
1- microbe that produce enzyme 2- purification procedure media (isolation, replication) 3- DNA
احتاج لعزل الانزيم 1- الميكروب الي ينتج الانزيم 2- الميديا الي انمي المكروب عليها 3- dnaالي اجرب اقطعه بلانزيم مالتي

16. PCR coloring