II. Learning Objectives

II. Learning Objectives
JS 111: Introduction to Genetics and DNA The Scientific Basis of DNA Typing Pre class activities Quiz Assignment and announcements II. Learning Objectives Understand why scientists study DNA. Introduction to Basic Genetics- Heredity Be able to define: cell, nucleus, chromosome, genetic linkage, alleles, homozygous vs heterozygous, independent segregation and random assortment Be able to draw a Punnett Square to illustrate allele inheritance Introduction to DNA Understand the Basic Facts and Function of DNA Be able to draw DNA structure – Base Pairing AT, GC Understand DNA replication Overview of Methods Used to study DNA Screening, Extraction, Quantification, Typing RFLP v PCR, Interpretation

Assignments and Announcements
Guest Speakers Monday Sept 19- Carolyn Gannett- Ethics of For Sci. Worth 5 points of extra credit – Thursday Oct 13- Mark Bennett- Shooting Reconstruction – 1030 am – 2 points extra credit Weds 2 Nov- Nusse- Facial Reconstruction Weds 23 Nov- Inman- Origin of error in For Sci Assignments

Who Cares? WE ALL DO! Law Enforcement
Criminal Investigation- Casework, Databanks Reuniting immigrant families- Paternity Missing persons Evolutionary, Agricultural and Zoological applications Assessing genetic diversity Fingerprinting endangered species and pathogens Assessing unrelatedness to breed for increasing genetic diversity Assessing relationships for all biological predictions Ancient DNA analyses for reconstructing history (how we populated the globe) Other Human Applications Making sense of the Human Genome project results- Bioinformatics Developing rapid medical diagnostics such as those associated with triplet repeat diseases (STRs)- (Moxon et al Sci Amer. 280:94) Understanding the molecular basis of development, disease and aging Screening candidates for bone marrow/organ transplants and grafts WE ALL DO!

Steps in Forensic DNA typing
(Figure 6.1 Rudin and Inman 2001) Evaluation- Is it there? 1. Start with biological sample 2. Screen- blood? Semen? Saliva, human? Extraction- Get and clean DNA 3. Open cells  Get DNA 4. Methods to get DNA and purify DNA Quantify- Determine quality and quantity? 5. Quantify- How good and how much did you get? Type to determine and compare alleles 6. RFLP vs PCR 7. Determine alleles and compare DNA types Or alleles present in samples and references Interpretation of Results

Where is it? How is it stored? DNA is found in every
DNA Facts and Jargon Where is it? How is it stored? DNA is found in every *cell= basic unit of life Inside nuclei (organization center for the cell) and mitochondria (ATP powerhouse of the cell) & chloroplasts for plants- (making our food via photosynthesis) Nuclei are not found in red blood cells In white blood cells, saliva, skin, hair fingernails, urine, feces, vomitus, earwax etc.

Individual nucleotides
DNA in the Cell In nuclei, mitochondria and chloroplasts (plants) organized in chromosomes (wound around histones) “DNA double bagging” chromosome cell nucleus Double stranded DNA molecule Individual nucleotides Target Region for PCR

I. Intro to DNA : Facts and Jargon DNA: Deoxyribonucleic acid
DNA: Deoxyribonucleic acid Different in every *individual The same in every **cell of an individual's body *except for identical twins that have the same DNA - "The time honored method of cloning humans" ** diseased individuals may be mosaics

DNA function What’s it do? DeoxyriboNucleic Acid : blueprints of life
Replication, Information Storage and Mutation Central Dogma information flow > DNA >RNA------>protein transcription translation

DNA Organization and Inheritance Human Genome Contains 23 Pairs of Chromosomes It is inherited from your mom and dad X Y Sex-chromosomes

Basic Chromosome Structure and Nomenclature
p (short arm) centromere telomere q (long arm) Band 5 Band 3 Chromosome 12 12p3 12q5 Chromosome 12 P= short arm Q= long arm Center= Centromere (involved in mitosis and meiosis attachment to spindle fibers) End= Telomere (involved in aging) D12S459 D= DNA 12= Chromosome 12 S=Single copy sequence 459= 459th locus described on C12

Definitions of Locus and Allele
2 pairs of Homologous chromosomes (white from dad, dark from mom) Locus (singular) or Loci (plural) are defined locations where specific genes or markers are found Alleles are different forms of the same gene or marker When alleles have the same form on a locus they are said to be homozygous. When different they are heterozygous

Where’s Daddy? 11 14 Father 12 14 Child #1 8 14 Child #2 11 12
PCR product size (bp) 11 14 Father 12 14 Child #1 8 14 Child #2 11 12 Child #3 8 12 Mother

Review- Mendelian Genetics
Law of Independent Segregation- Big D and little d will evenly segregate into the next generation And results in equal inheritance from mom and dad Name Genotype Gametes possible Steve D,D D Julie d,d d D d d Dd Dd Punnett Square

Inheritance Review Dad is homozygous (A, A) and mom is heterozygous (A, a). In your teams, draw the Punnett Sqaure that demonstrates the inheritance of these alleles. What percentage of their children will be heterozygous?

Review- Mendelian Genetics Law of Random Assortment
This law states that markers on different chromosomes are generally inherited independently of one another and are not inherited together more often than might be expected by chance. Those displaying random assortment are said to be in linkage equilibrium. Those that show genetic linkage such as those located close together on the same chromosome are said to be in linkage disequilibrium and are found more often together than expected by chance. Example is blonde hair and blue eyes. Markers that are in linkage equilibrium are desirable for forensic DNA. The product rule can be applied to those displaying random assortment thus resulting in a higher power of discrimination than those that are linked.

Phosphate-sugar backbone
DNA Structure What is it? Bases (AGCT) form the stairs of the ladder, are faithfully paired and exhibit differences. P S-A : T-S P P S-G : C-S Sugars (S) and phosphates (P) form the sides of the ladder (identical for all DNA). Bases (AGCT) form the stairs of the ladder, are faithfully paired by hydrogen bonds and exhibit differences. A : T and G : C A = T G  C T = A C  G T C A G 5’ 3’ denatured strands hybridized Hydrogen bonds Phosphate-sugar backbone

DNA Structure Primary genetic material is composed of two complementary strands Form a double helix or twisted ladder Sides are sugar phosphate and the steps are base pairs Four Bases- 2 Purines – Adenine and Guanine and 2 Pyrimidines- Cytosine and Thymine Asian Guys are Pure!

DNA Structure Nucleotides are the building blocks themselves composed of PBS
Nucleotides-PBS Phosphate (negative charge) Base (AGCT-Asian Guys Can Teach) Sugar (deoxyribose-5C) Phosphate-Sugars Connected by phosphodiester linkages

Basic Components of Nucleic Acids
Phosphate Sugar Base 5’end | Phosphate Sugar—Base… 3’end

DNA Structure 2 Complimentary, Antiparallel Strands held together by Base Pairs- H Bonds
. A:T held with 2 H Bonds G:C held with 3 H Bonds

Polymerase Chain Reaction:
PCR is simply repeated rounds of DNA replication PCR based systems are rapid, require less material than RFLP and less time for typing Molecular xeroxing Calvin and Hobbes example

Replication of DNA is Semi Conservative One old and one new http://dir
Enzymes of Replication DNA is replicated or copied in our cells. When completed, the new double strands consist of one old template and one newly made strand- This is called semi conservative replication. There are many enzymes that are required. They include unwinding (helicases, gyrases), priming (primases), copying (DNA polymerases) and touch up enzymes (DNA ligases).

DNA Replication 5-P’ Primer 3-OH’ 3-OH’ dNTP Mg++ Template = Old
5 required ingredients (components)- primer, template, Mg, dntps, DNA polymerase- PTMDD-(please to make DNA doubled) DNA Polymerase catalyzes the template directed (A-T, G-C), incorporation of dNTPs (PP is released) forming a 3’-5’ phosphodiester linkage Direction of synthesis 5’3’ using primer 3’OH to attach incoming nucleotide 5-P’ Primer 3-OH’ 3-OH’ dNTP P-P- OH Mg++ Template = Old DNA polymerase 5-P’

DNA St. Patricks Day Salute to the Molecule of Heredity From Biology 110- UNC 1993 Steve Lee
The molecular structure today Is heredity’s DNA With nucleotides completely comprised of a sugar and phosphate and base The bases you see are so keen They include thymine and adenine Cytosine and one more with guanine can store all the info with rungs in between The sides of the ladder you know, are sugar and phosphate which show that Franklin was right double helix is tight ten base pairs per turn in a row Adenine and thymine can base pair Forming two hydrogen bonds for one stair Cytosine and guanine pair with three in between and are equal in size when compared DNA strands are just not the same One is coding and one is called lame (anticoding) They are opposite in direction and this is called antiparallel in name Complimentary nature of strands lets replication proceed just as planned with A paring to T and G pairing to C the fidelity is precise and quite grand

Review: DNA is organized inside the cell nucleus and mitochondria

DNA Extraction After screening tests are performed, a spot of the material containing the biological sample is cut and placed into a tube. In one type of extraction method (organic), heat and chemicals are added, and protein is removed. Then the pure DNA is recovered by filtration in which the non-DNA material goes through a sieve. (analogous to a collection of your pasta in a colander)

Different DNA Extraction Methods
The organic method generally yields the highest quantity and quality DNA. The main disadvantages are that it is tedious with lots of steps and utilizes corrosive chemicals. The Chelex method is used when the sample contains very few cells and the reduced number of handling steps is the primary advantage. The main disadvantage is that it is yields crude DNA that is not as pure FTA paper is used to collect reference samples. It can be stored at room temperature, requires minimal handling and no quantification is required.

Differential Extraction Method For Sexual Assault Evidence
Female cell Spermatozoa Isolation of DNA from mixtures of cells in sexual assault evidence Based on differences in cell membranes Spermatozoa membranes have special cross links (sulphur-sulphur bonds) These membranes are quite resistant to opening. Vaginal epithelial cells do not contain these membranes and are more easily broken open Sperm and v cell mixture Lysis- open v cell extract Female DNA Female DNA Lysis- open sperm extract Male DNA Male DNA

Quantification of DNA Following extraction, the next step is to determine the quantity of the DNA DNA typing methods RFLP and PCR require different amounts and different quality of DNA. RFLP typically required 50ng. PCR typically requires less than 0.5ng to 1 ng: 100 times less!

Quantification of DNA using Gel Electrophoresis
(-) Total DNA can be quantified by running the samples in a gel. Typically, gels are made up of agarose (a carbohydrate from seaweed). Known DNA quantities are included Samples are then subject to an electric current and is called electrophoresis. DNA is negatively charged and will migrate toward the positive electrode… Comparisons of the results are done visually or with computer software to determine the amount of DNA in the unknown sample. L K K – u u u wells Intact DNA Degraded DNA (+) Direction of DNA fragment movement Smaller fragments move faster and are found Near the bottom of the gel

Slot Blot quantification : DNA-DNA Hybridization DNA is where it’s AT
DNA samples may contain non human DNA In order to quantify the amount of human DNA in a sample, a human specific test is required One such test is DNA-DNA hybridization using a human specific probe: D17Z1

Slot blot hybridization
Like in yield gels, known amounts of DNA (human) are included DNA hybridization of D17Z1 will occur only if the sample contains human DNA Detection of the hybridized fragments is done using an enzyme linked assay- yielding light or color

Real Time PCR

Quantitative PCR- QPCR http://pathmicro.med.sc.edu/RTPCR/rt-pcr.ppt
Real-time QPCR has several advantages over the other methods in that it is extremely accurate and sensitive over a broad dynamic range, and it occurs in a closed-tube system, reducing the potential for carryover contamination. Using this technique, a forensic biologist can monitor and quantify the accumulation of PCR products during log phase amplification. (Heid et al., 1996). Several RT PCR human specific assays are now available that target autosomal, Alu repeats, Y chromosome and mtDNA (Andréasson et al. 2002, Nicklas et al. 2003, Green et al. 2005, Andréasson et al. 2006, Horsman et al. 2006). The assays may be performed on single targets or in multiplexes (Timken et al. 2005, Walker et al. 2005, Nicklas et al. 2006). Recently, the detection of degraded vs intact human DNA and PCR inhibitors has been reported (Swango et al. 2006).

RNA based quantification methods
Different genetic expression patterns (mRNAs) exist in different tissue types. Body fluid identification has been reported based on their mRNA profiles (Juusola and Ballantyne 2003 and 2005, Nussbaumer et al. 2006) In addition, the age of a bloodstain was reported using analysis of mRNA: rRNA ratios (Anderson et al. 2005). This information may be useful in establishing the time of the crime. Advantages of the mRNA-based approach, versus the conventional biochemical tests, include greater specificity, simultaneous and semi-automatic analysis, rapid detection, decreased sample consumption and compatibility with DNA extraction methodologies. The quantification of the amounts of the mRNA species relative to housekeeping genes is a critical aspect of the assays (Juusola and Ballantyne 2003).

Comparison of Methods used for DNA Quantification
Method Ease Cost Sensitivity Result UV Spectrophotometry Total DNA Yield Gel electrophoresis Int vs deg DNA Slot Blot Human DNA Yield Gel blot Int. vs. deg human DNA Pico-green microtitre plate Total DNA Alu Quant Human DNA Real time PCR assays Human DNA Real time PCR assays Int.vs. deg.Human DNA

Summary 1 (from last week)
Why study DNA Law enforcement, evolution, agricultural, and human applications-medical diagnostics DNA Biology and Genetics DNA is contained in cells –the basic unit of life Found in nuclei, mitochondria and chloroplasts Organized in chromosomes. Located at positions called loci and come in different forms or alleles. Homozygous if the same, heterozygous if different Alleles segregate independently and assort randomly when on different chromosomes. Random assortment is desired for forensic DNA loci. DNA Function and Structure DeoxyriboNucleic Acid : blueprints of life Replication, Information storage and mutation RIM Central Dogma DNA >RNA------>protein transcription translation

Summary 2 DNA Structure and Function continued: DNA Replication
Bases are Adenine, Guanine, Cytosine and Thymine- Asian Guys Can Teach: AGCT Base pairing is A to T and G to C- DNA is where its AT Sequence of Bases Store information- Like the sequence of numbers in a Phone Number Sides of the ladder are Sugar-Phosphate backbones Nucleotides are the building blocks (dNTPs) themselves made of phosphate base and sugar= PBS- The only station Sierra and Gabriel can watch DNA base pairs- DNA velcro (David Letterman DNA Replication Semi-conservative- Half republican (old) /half democrat (new) Template directed with base pairing (AT, GC) 5 required ingredients of PCR - primer, template, Mg, dntps, DNA polymerase (PTMDD)

Summary 3 Steps in forensic DNA typing are – Evaluation, Extraction, Quantification, Typing and Interpretation 1) Evaluation- Is it there? Screen- blood? Semen? Saliva, human? 2) Extraction- Get and clean DNA Open cells -Get DNA 3) Quantify- Determine quality and quantity? How good and how much did you get? Yield Gels, Slot Blots, Real time qPCR assays

Case #2: Can you extract and type DNA from fingerprint powder that has been used to develop latent prints? If so, design an experiment with + and – controls to support your hypothesis.

RFLP- Rudin and Inman

DNA Methods 1) Extract 2) Quantitate 3) Distinguish Size Content
RFLP : Restriction Fragment Length Polymorphisms PCR: Polymerase Chain Reaction RFLP methods require large amounts of undegraded DNA and the process takes 1-2 weeks. PCR methods require only small amounts of DNA, are useful on degraded DNA and require much less time (as little as 1-2 days in some cases).

The base sequence can exhibit differences in length and content between individuals.
Christina Aguilera ... AAAGAAAGAAGAAAC... Lady Gaga ... AAAGAAAGAAGA... The Suburbs ... AAAGAAAGAAGT... Lady Antibellum ... AAAGAAAGAAGA... Esperanza Spalding ... AAAGAAAGAA... Eminem AAAGAAAGA... Train AAAGAAAGC... Norah Jones AAAGAAAGT... Boyz to Men ... AAAGAAAG… Although different between individuals* DNA is identical in every cell of an individuals body** Some exceptions*identical twins**diseased individuals, mtDNA (sport analogs)

Classroom RFLP Everyone get a base- Blue=A, Green=G, Yellow=C, Red =T
Form GGCCAATTCCGGTTAAGATC- hold hands or papers (It is valentine’s day!) You are the DNA we will cut and separate on a gel (in the class) Set DNA in the ‘well’= front of class Enzyme role= Cut between GG-CC Turn on power (electrophoresis). Migrate through the gel (classroom desks). Stop when power is off. Observe separation

RFLP Spencer

Comparison of RFLP and PCR
Characteristic RFLP Methods PCR Methods Time required to obtain results 6-8 weeks with radioactive probes; ~1 week with chemiluminescent probes 1-2 days Amount of DNA needed ng 0.1-1 ng Condition of DNA needed high molecular weight, intact DNA may be highly degraded Capable of handling sample mixtures Yes (single locus probes) Yes Allele identification Binning required Discrete alleles obtained Power of Discrimination ~1 in 1 billion with 6 loci ~1 in 1 billion with 8-13 loci (requires more loci)

Relative power of tests
Test type time power RFLP-VNTR weeks +++ * PCR: DQAlpha- macroarray 1 day + PM - macroarray 1 day ++ D1S80 - gel- VNTR 2 days ++ STRs -gel,CE, arrays 2 days +++ mtDNA- gel, CE, arrays 2 days + alu -gel, CE, arrays 2 days ++ * not useful on degraded DNA

Summary 1 Why study DNA DNA Biology and Genetics
Law enforcement, evolution, agricultural, and human applications-medical diagnostics DNA Biology and Genetics DNA is contained in cells –the basic unit of life Found in nuclei, mitochondria and chloroplasts Organized in chromosomes. Located at positions called loci and come in different forms or alleles. Homozygous if the same, heterozygous if different Alleles segregate independently and assort randomly when on different chromosomes. Random assortment is desired for forensic DNA loci. DNA Function and Structure DeoxyriboNucleic Acid : blueprints of life Replication, Information storage and mutation RIM Central Dogma DNA >RNA------>protein transcription translation

Summary 2 DNA Structure and Function continued: DNA Replication
Bases of DNA are Adenine, Guanine, Cytosine and Thymine- Asian Guys Can Teach: AGCT Base pairing is A to T and G to C- DNA is where its AT Sequence of Bases Store information- Like the sequence of numbers in a Phone Number Nucleotides are the building blocks (dNTPs) themselves made of phosphate base and sugar= PBS- The only station Sierra and Gabriel can watch DNA base pairs- DNA velcro (David Letterman DNA Replication Semi-conservative- Half republican (old) /half democrat (new) Template directed with base pairing (AT, GC) 5 required ingredients- primer, template, Mg, dntps, DNA polymerase (PTMDD)

DNA Methods 1) Extract 2) Quantitate 3) Distinguish Size Content
RFLP : Restriction Fragment Length Polymorphisms PCR: Polymerase Chain Reaction RFLP methods require large amounts of undegraded DNA and the process takes 1-2 weeks. PCR methods require only small amounts of DNA, are useful on degraded DNA and require much less time (as little as 1-2 days in some cases).

Kary Mullis Nobel Prize - 1993

Polymerase Chain Reaction:
PCR is simply repeated rounds of DNA replication PCR based systems are rapid, require less material than RFLP and less time for typing Molecular xeroxing Calvin and Hobbes example

PCR works for very small samples—bloodstain on hat

PCR works for very small samples—hat close-up

PCR works for degraded DNA—under the microscope, sperm appear intact

But the yield gel shows that their DNA is degraded

PCR: repeated rounds of DNA Replication
5 required ingredients (components)- primer, template, Mg, dntps, DNA polymerase- PTMDD-(please to make DNA doubled) DNA Polymerase catalyzes the template directed (A-T, G-C), incorporation of dNTPs (PP is released) forming a 3’-5’ phosphodiester linkage Direction of synthesis 5’3’ using primer 3’OH to attach incoming nucleotide 5-P’ Primer 3-OH’ 3-OH’ dNTP P-P- OH Mg++ Template = Old DNA polymerase 5-P’

DNA Amplification with the Polymerase Chain Reaction (PCR)
Separate strands (denature) 5’ 3’ Starting DNA Template 5’ 3’ Add primers (anneal) 5’ 3’ Forward primer Reverse primer 5’ 3’ Make copies (extend primers) In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

PCR takes place in a Thermal Cycler

Thermal Cycling Temperatures
94 oC 94 oC 94 oC 94 oC Single Cycle The denaturation time in the first cycle is lengthened to ~10 minutes when using AmpliTaq Gold to perform a “hot-start” PCR 72 oC 72 oC 72 oC Temperature 60 oC 60 oC 60 oC Time Typically cycles performed during PCR

PCR Process 5’ 3’ Separate strands (denature) Add primers (anneal) 5’
Starting DNA Template 5’ 3’ Separate strands (denature) Add primers (anneal) 5’ 3’ Forward primer Reverse primer Make copies (extend primers) Repeat Cycle, Copying DNA Exponentially

PCR is simply repeated rounds of DNA replication
5’ 3’ 3’ 5’ Template- DNA from blood etc. Step 1: Denature Separate H bonds with heat at 95C 95C 5’ 3’ 3’ 5’ 55C 3’ 5’ Step 2: Anneal Primers bind at lower temp 55C 5’ 3’ 3’ 5’ 5’ 3’ 72C Step 3: Extend Taq polymerase extends primer 3’OH at 72C (dNTPs and Mg++) Step 4: Repeated rounds of D, A, E 5’ 3’ 3’ 5’

Number of Target Molecules Created
1 2 3 4 5 8 6 16 7 32 64 9 128 10 256 11 512 12 1024 13 2048 14 4096 15 8192 16,384 17 32,768 18 65,536 19 131,072 20 262,144 21 524,288 22 1,048,576 23 2,097,152 24 4,194,304 25 8,388,608 26 16,777,216 27 33,544,432 28 67,108,864 29 134,217,728 30 268,435,456 31 536,870,912 1,073,741,824 Cycle Number Number of Double-stranded Target Molecules

Comparison of RFLP and PCR
Characteristic RFLP Methods PCR Methods Time required to obtain results 6-8 weeks with radioactive probes; ~1 week with chemiluminescent probes 1-2 days Amount of DNA needed ng 0.1-1 ng Condition of DNA needed high molecular weight, intact DNA may be highly degraded Capable of handling sample mixtures Yes (single locus probes) Yes Allele identification Binning required Discrete alleles obtained Power of Discrimination ~1 in 1 billion with 6 loci ~1 in 1 billion with 8-13 loci (requires more loci)

Relative power of tests
Test type time power RFLP-VNTR weeks +++ * PCR: DQAlpha- macroarray 1 day + PM - macroarray 1 day ++ D1S80 - gel- VNTR 2 days ++ STRs -gel,CE, arrays 2 days +++ mtDNA- gel, CE, arrays 2 days + alu -gel, CE, arrays 2 days ++ * not useful on degraded DNA

Advantages of PCR Minute amounts of DNA template may be used from as little as a single cell. DNA degraded to fragments only a few hundred base pairs in length can serve as effective templates for amplification. Large numbers of copies of specific DNA sequences can be amplified simultaneously with multiplex PCR reactions. Contaminant DNA, such as fungal and bacterial sources, will not amplify because human-specific primers are used. Commercial kits are now available for easy PCR reaction setup and amplification.

Potential Pitfalls of PCR
The target DNA template may not amplify due to the presence of PCR inhibitors in the extracted DNA Amplification may fail due to sequence changes in the primer binding region of the genomic DNA template Contamination from other human DNA sources besides the forensic evidence at hand or previously amplified DNA samples is possible without careful laboratory technique and validated protocols

Multiplex PCR Target 2 or more DNA regions simultaneously with multiple primer sets. Copy more than one locus at a time Primers for all loci are present in the tube Conditions are adjusted to ensure all loci will be amplified Multiple types obtained from 1-2 ng DNA Greater discrimination Advantages: more information in the same amount of time less expensive (lower reagents and labor) Challenge lies in designing PCR primers that are compatible with one another

Primer Design Typically performed with assistance of computer program to identify possible primer that are then tested empirically Various computer programs: Gene Runner (PC), Oligo (PC/Mac), Primer Express (Mac) Primer 3 (web based) Critical parameters examined: Predicted Tm (melting temperature)- Tm=4(G+C) + 2(A+T) Primer dimer and hairpin formation Contiguous base runs (usually <5 bases) GC content (number of G and C nucleotides within primer)

Schematic of Multiplex PCR
Locus A Locus C Locus B A C B small large

Multiplex PCR Over 15 Markers Can Be Copied at Once
Sensitivities to levels less than 1 ng of DNA Ability to Handle Mixtures and Degraded Samples Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges

Important PCR facts DNA polymerase is taq polymerase from a hot springs (can survive denaturation boiling temperatures) Taq likes to add an extra base (non template directed nucleotide addition to the 3’ end). Amplification of DNA fragments of 100bp in size are 101 in length. PCR amplification sometimes “stutters” on STRs resulting in an extra PCR product called a stutter product. Eg. Both 100 (correct type) and 96 base pair fragments are present. The stutter product is usually represented at less than 10% of the real allele.

Real Time PCR

Quantitative PCR- QPCR http://pathmicro.med.sc.edu/RTPCR/rt-pcr.ppt
Real-time QPCR has several advantages over the other methods in that it is extremely accurate and sensitive over a broad dynamic range, and it occurs in a closed-tube system, reducing the potential for carryover contamination. Using this technique, a forensic biologist can monitor and quantify the accumulation of PCR products during log phase amplification. (Heid et al., 1996). Several RT PCR human specific assays are now available that target autosomal, Alu repeats, Y chromosome and mtDNA (Andréasson et al. 2002, Nicklas et al. 2003, Green et al. 2005, Andréasson et al. 2006, Horsman et al. 2006). The assays may be performed on single targets or in multiplexes (Timken et al. 2005, Walker et al. 2005, Nicklas et al. 2006). Recently, the detection of degraded vs intact human DNA and PCR inhibitors has been reported (Swango et al. 2006).

RNA based quantification methods
Different genetic expression patterns (mRNAs) exist in different tissue types. Body fluid identification has been reported based on their mRNA profiles (Juusola and Ballantyne 2003 and 2005, Nussbaumer et al. 2006) In addition, the age of a bloodstain was reported using analysis of mRNA: rRNA ratios (Anderson et al. 2005). This information may be useful in establishing the time of the crime. Advantages of the mRNA-based approach, versus the conventional biochemical tests, include greater specificity, simultaneous and semi-automatic analysis, rapid detection, decreased sample consumption and compatibility with DNA extraction methodologies. The quantification of the amounts of the mRNA species relative to housekeeping genes is a critical aspect of the assays (Juusola and Ballantyne 2003).

Comparison of Methods used for DNA Quantification
Method Ease Cost Sensitivity Result UV Spectrophotometry Total DNA Yield Gel electrophoresis Int vs deg DNA Slot Blot Human DNA Yield Gel blot Int. vs. deg human DNA Pico-green microtitre plate Total DNA Alu Quant Human DNA Real time PCR assays Human DNA Real time PCR assays Int.vs. deg.Human DNA

Potential Pitfalls of PCR
The target DNA template may not amplify due to the presence of PCR inhibitors in the extracted DNA Amplification may fail due to sequence changes in the primer binding region of the genomic DNA template Contamination from other human DNA sources besides the forensic evidence at hand or previously amplified DNA samples is possible without careful laboratory technique and validated protocols

Tips for Avoiding Contamination
Pre- and post-PCR sample processing areas should be physically separated. Do not move from PCR area into non PCR area without decontamination Process one sample at a time, Avoid splashing Separate reference samples from evidence Wear protective gear and reagent prep care Equipment, such as pipettors, and reagents for setting up PCR should be kept separate from other lab supplies, especially those used for analysis of PCR products. Disposable gloves should be worn and changed frequently. Reactions may also be set up in a laminar flow hood, if available. Aerosol-resistant pipet tips should be used and changed on every new sample to prevent cross-contamination during liquid transfers. Reagents should be carefully prepared to avoid the presence of any contaminating DNA or nucleases. Ultraviolet irradiation of laboratory PCR set-up space when the area is not in use and cleaning workspaces and instruments with isopropanol and/or 10% bleach solutions help to insure that extraneous DNA molecules are destroyed prior to DNA extraction or PCR set-up Controls: Negative, Positive, Stochastic, Substrate

Monitoring for Contamination—Controls ‘R’ Us
Bloodstain (Evidence) Substrate Control Reagent Blank—for Evidence Victim’s Reference Sample Reagent Blank—for References Negative Amplification Control Quality Control Sample Positive Amplification Control

Summary RFLP (old) required approximately 50ng of DNA at a minimum. PCR requires as little at 500pg or 100 times less! One method to examine variation of variable number of tandem repeats (VNTRs) is RFLP= restriction fragment length polymorphisms RFLP requires many steps, undegraded DNA and takes days to weeks to complete In contrast, typing of STRs using PCR can be performed on very small amounts of degraded DNA and takes hours to a day to complete.

Summary 2 PCR is polymerase chain reaction and is repeated rounds of DNA synthesis. There are 5 components needed, PTMDD. PCR takes place in a thermal cycler Multiplex PCR permits amplification of many loci simultaneously and saves time Avoid contamination and use controls Other markers that have been used in forensic PCR assays include, dot blot assays of DQ alpha, polymarker, and D1S80. Mitochondrial DNA sequencing and Y chromosome STR markers are also being used.

PCR ‘quiz’ Template = 5’GGACTCCTATGTATGTATGCTTTAAGGCA 3’ 3’CCTGAGGATACATACATACGAAATTCCGT 5’ Design two primers (five bases long): Remember-the 3’ OH end will be extended and DNA is antiparallel Be sure to amplify the entire template. List the other required components, materials and procedure needed to conduct a successful PCR reaction Assume this is an STR locus. What is the repeat unit? What is the type (number of repeats for this allele)?

Reverse Dot blot hybridization eg. DQ alpha and Polymarker

Once amplified detection can be done by DNA battleship

Quantification References
Anderson S, Howard B, Hobbs GR, Bishop CP. (2005) A method for determining the age of a bloodstain. Forensic Sci Int Feb 10;148(1): Links Andreasson H, Gyllensten U, Allen M. (2002) Real-time DNA quantification of nuclear and mitochondrial DNA in forensic analysis. Biotechniques Aug;33(2):402-4, Andreasson H, Nilsson M, Budowle B, Lundberg H, Allen M. (2006) Nuclear and mitochondrial DNA quantification of various forensic materials. Forensic Sci Int Jan 18; Budowle B, Hudlow WR, Lee SB, Klevan L. (2001) Using a CCD camera imaging system as a recording device to quantify human DNA by slot blot hybridization. Biotechniques Mar;30(3):680-5. Butler, J (2005) Forensic DNA Typing: Biology and Technology Behind STR Markers ISBN: , 688pp. Academic Press. Fox JC, Cave CA, Schumm JW. (2003) Development, characterization, and validation of a sensitive primate-specific quantification assay for forensic analysis. Biotechniques Feb;34(2):314-8, 320, 322. Links Green RL, Roinestad IC, Boland C, Hennessy LK. (2005) Developmental validation of the quantifiler real-time PCR kits for the quantification of human nuclear DNA samples. J Forensic Sci Jul;50(4): Heid CA, Stevens J, Livak KJ, Williams PM. (1996) Real time quantitative PCR. Genome Res Oct;6(10): Horsman KM, Hickey JA, Cotton RW, Landers JP, Maddox LO. (2006) Development of a human-specific real-time PCR assay for the simultaneous quantitation of total genomic and male DNA. J Forensic Sci Jul;51(4): Jones (2005)- Forensic Science Handbook Saferstein editor Forensic Science Handbook, Volume II, 1/e Richard Saferstein, Bill Bliss, Arlington, VA ©1988 / ISBN: Juusola J, Ballantyne J. (2003) Messenger RNA profiling: a prototype method to supplant conventional methods for body fluid identification. Forensic Sci Int Aug 12;135(2):85-96. Juusola J, Ballantyne J. (2005) Multiplex mRNA profiling for the identification of body fluids. Forensic Sci Int Aug 11;152(1):1-12. Kline, M.C., Duewer, D.L., Redman, J.W., Butler, J.M. (2003) NIST mixed stain study 3: DNA quantitation accuracy and its influence on short tandem repeat multiplex signal intensity. Anal. Chem. 75: Kline, M.C., Duewer, D.L., Redman, J.W., Butler, J.M. (2005) Results from the NIST 2004 DNA Quantitation Study. J. Forensic Sci., 50(3): Mandrekar MN, Erickson AM, Kopp K, Krenke BE, Mandrekar PV, Nelson R, Peterson K, Shultz J, Tereba A, Westphal N. (2001) Development of a human DNA quantitation system. Croat Med J Jun;42(3):336-9. Nicklas JA, Buel E. (2003) Development of an Alu-based, QSY 7-labeled primer PCR method for quantitation of human DNA in forensic samples, Journal of Forensic Sciences, Vol 48, No 2, , 2003. Nicklas JA, Buel E, (2003) Development of an Alu-based, real-time PCR method for quantitation of human DNA in forensic samples, Journal of Forensic Science, Vol 48, No 5, , 2003. Nicklas JA, Buel E, (2003) Quantitation of DNA in Forensic Samples, Analytical and Bioanalytical Chemistry, Vol 376, No. 8, , 2003. Nicklas JA, Buel E. (2006) Simultaneous determination of total human and male DNA using a duplex real-time PCR assay. J Forensic Sci Sep;51(5): Nussbaumer C, Gharehbaghi-Schnell E, Korschineck I. (2006) Messenger RNA profiling: a novel method for body fluid identification by real-time PCR. Forensic Sci Int Mar 10;157(2-3): Epub 2005 Nov 9. Swango, KL, MD.Timken, M.Date-Chong, MR Buoncristiani (2006) A quantitative PCR assay for the assessment of DNA degradation in forensic samples. Forensic Science International 158:14-26. Timken MD, Swango KL, Orrego C, Buoncristiani MR (2005) A duplex real-time qPCR assay for the quantification of human nuclear and mitochondrial DNA in forensic samples: Implications for quantifying DNA in degraded samples. J Forensic Sci. Sep;50(5): Walker JA, Hedges DJ, Perodeau BP, Landry KE, Stoilova N, Laborde ME, Shewale J, Sinha SK, Batzer MA. (2005) Multiplex polymerase chain reaction for simultaneous quantitation of human nuclear, mitochondrial, and male Y-chromosome DNA: application in human identification. Anal Biochem Feb 1;337(1):89-97. Walsh, PS, J. Varlaro, and R. Reynolds (1992) A rapid chemiluminescent method for quanititation of human DNA Nucl. Acids Res : Waye JS, Presley LA, Budowle B, Shutler GG, Fourney RM. (1989) A simple and sensitive method for quantifying human genomic DNA in forensic specimen extracts. Biotechniques Sep;7(8):852-5. Singer VL, Jones LJ, Yue ST, Haugland RP. (1997) Characterization of PicoGreen reagent and development of a fluorescence-based solution assay for double-stranded DNA quantitation.Anal Biochem Jul 1;249(2): Links

II. Learning Objectives

Similar presentations

Presentation on theme: "II. Learning Objectives"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

II. Learning Objectives

Similar presentations

Presentation on theme: "II. Learning Objectives"— Presentation transcript:

Similar presentations

About project

Feedback