Download presentation
Presentation is loading. Please wait.
1
From Gene to Protein How Genes Work
2
Metabolism taught us about genes
Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4
3
hydroxyphenylpyruvic acid maleylacetoacetic acid
ingested protein digestion phenylalanine PKU phenylketonuria phenylalanine hydroxylase tyrosine albinism melanin transaminase cretinism thyroxine hydroxyphenylpyruvic acid hydroxyphenylpyruvic acid oxidase tyrosinosis homogentisic acid homogentisic acid oxidase alkaptonuria maleylacetoacetic acid CO2 & H2O
4
1 gene – 1 enzyme hypothesis
Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA damage a gene wild type grows on minimal media sugars + required nutrients allows fungus to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme from damaged gene
5
Beadle & Tatum Wild-type Neurospora Minimal medium Select one of
the spores Grow on complete medium control Nucleic acid Choline Pyridoxine Riboflavin Arginine Minimal media supplemented only with… Thiamine Folic Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete X rays or ultraviolet light asexual spores create mutations positive control negative control mutation identified experimentals amino acid supplements
6
One gene / one enzyme hypothesis
Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E arg-G arg-H arg-F encoded enzyme enzyme E enzyme F enzyme G enzyme H glutamate ornithine citruline argino- succinate arginine substrate in biochemical pathway gene that was damaged
7
one gene : one enzyme hypothesis
1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"
8
DNA gets all the glory, but proteins do all the work!
The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication
9
DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs
uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA
10
from DNA nucleic acid language to RNA nucleic acid language
Transcription from DNA nucleic acid language to RNA nucleic acid language
11
Transcription Making mRNA transcribed DNA strand = template strand
untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5
12
Transcription in Prokaryotes
Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall
13
Transcription in Prokaryotes
Initiation RNA polymerase binds to promoter sequence on DNA Role of promoter Starting point where to start reading start of gene Template strand which strand to read Direction on DNA always read DNA 35 build RNA 53
14
Transcription in Prokaryotes
Promoter sequences enzyme subunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase molecules bound to bacterial DNA RNA polymerase
15
Transcription in Prokaryotes
Elongation RNA polymerase copies DNA as it unwinds ~20 base pairs at a time bases in gene builds RNA 53 Simple proofreading 1 error/105 bases make many mRNAs mRNA has short life not worth editing! reads DNA 35
16
Transcription in Prokaryotes
Termination RNA polymerase stops at termination sequence
17
Transcription in Eukaryotes
RNA Processing Psssst… DNA can’t leave nucleus! Translation Protein
18
Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
19
Transcription in Eukaryotes
3 RNA polymerase enzymes RNA polymerase 1 transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 transcribes tRNA genes each has a specific promoter sequence it recognizes
20
Transcription in Eukaryotes
Initiation complex transcription factors bind to promoter region upstream of gene suite of proteins which bind to DNA turn on or off transcription TATA box binding site recognition site for transcription factors transcription factors trigger the binding of RNA polymerase to DNA
21
Protecting RNA – Posttranscriptional modification
Protecting RNA – Posttranscriptional modification 5’ cap added G trinucleoside (G-P-P-P) protects mRNA from RNase (hydrolytic enzymes) 3’ poly-A tail added A’s helps export of RNA from nucleus UTR UTR
22
Dicing & splicing mRNA Pre-mRNA mRNA edit out introns
Dicing & splicing mRNA “AVERAGE”… “gene” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “JUNK”! Pre-mRNA mRNA edit out introns intervening sequences splice together exons expressed sequences In eukaryotes: 90% or more of gene can be intron average size gene (transcription unit) = bases average size primary transcript = 8000 bases average size mature RNA = 1200 bases average size protein = 400 amino acids lots of “junk DNA”
23
Splicing enzymes snRNPs Spliceosome several snRNPs
small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA No, not smurfs! “snurps”
24
Ribozyme 1982 | 1989 RNA as ribozyme some mRNA can even splice itself
RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado
25
Alternative splicing Alternative mRNAs produced from same gene
Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Hard to define a gene!
26
Domains Modular architecture of many proteins
Domains Modular architecture of many proteins separate functional & structural regions coded by different exons in same “gene”
27
Summary of Post-transcriptional processing
Primary transcript (pre-mRNA) eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA) mRNA splicing = edit out introns protect mRNA from enzymes in cytoplasm add 5 cap add polyA tail 3' poly-A tail 3' A A A A A 5' cap mRNA A’s P P P 5' G eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
28
Splicing details No room for mistakes!
Splicing details No room for mistakes! editing & splicing must be exactly accurate a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
29
if you don’t know what a wabbit looks like.
Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 RNA gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. 1990s -- thought humans had 100,000 genes ,000 was considered a good estimate ,000 ,000 is our best estimate gene polypeptide 1 polypeptide 2 polypeptide 3
30
from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language
31
Making proteins – organelle review
Organelles nucleus ribosomes endoplasmic reticulum (ER) Golgi apparatus vesicles small ribosomal subunit nuclear pore mRNA large ribosomal subunit cytoplasm
32
Nucleus & Nucleolus
33
Nucleolus Function ribosome production
build ribosome subunits from rRNA & proteins exit through nuclear pores to cytoplasm & combine to form functional ribosomes small subunit large subunit ribosome rRNA & proteins nucleolus
34
Ribosomes Function Structure protein production rRNA & protein
small subunit large Ribosomes Function protein production Structure rRNA & protein 2 subunits combine 0.08mm Ribosomes Rough ER Smooth The genes for rRNA have the greatest commonality among all living things. There is very little difference in the DNA sequence of the rRNA genes in a humans vs. a bacteria. Means that this function (building of a ribosome) is so integral to life that every cell does it almost exactly the same way. Change a base and this changes the structure of the RNA which causes it to not function. rRNA genes are always turned on.
35
The "S" stands for svedbergs, a unit used to measure how fast molecules move in a centrifuge.
Some antibiotics (tetracycline and streptomycin) inactivate bacterial ribosomes
36
Types of Ribosomes Free ribosomes Bound ribosomes suspended in cytosol
synthesize proteins that function in cytosol Bound ribosomes attached to endoplasmic reticulum synthesize proteins for export or for membranes membrane proteins
37
endoplasmic reticulum
TO: nucleus protein on its way! TO: DNA RNA vesicle TO: TO: vesicle ribosomes TO: protein finished protein Golgi apparatus Making Proteins
38
Translation in Prokaryotes
Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall
39
Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed
40
Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing
41
Translation in Eukaryotes
42
How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?
43
mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein
44
WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT
1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine (phe)
45
The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG
46
How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC Met GCA Arg amino acid CAU Val anti-codon
47
Transfer RNA structure (45 different tRNAs)
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end
48
tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Loading tRNA Aminoacyl tRNA synthetase (20 – 1 for each aa) enzyme which bonds amino acid to tRNA bond requires energy ATP AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
49
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A
50
Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A
51
Building a polypeptide
1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'
55
start of a secretory pathway
Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway
56
Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA
exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome
57
Gene Mutations
58
Chromosomal Mutations
60
Cystic Fibrosis
Similar presentations
