Presentation is loading. Please wait.

Presentation is loading. Please wait.

Transcription, Translation & Protein Synthesis

Published byEthan Daniel Modified over 6 years ago

Similar presentations

Presentation on theme: "Transcription, Translation & Protein Synthesis"— Presentation transcript:

1 Transcription, Translation & Protein Synthesis

2 Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm.

3 Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

4 Ribonucleic Acids (RNA)
The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: mRNA – carries a message from the DNA to the ribosome tRNA – transports amino acids to the mRNA to make a protein rRNA – make up ribosomes, which make protein.

5 Ribonucleic Acids (RNA)
RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains uracil instead of thymine. RNA is single-stranded, not double-stranded

6 Ribonucleic Acids (RNA)

7 Protein Synthesis Occurs in TWO steps:
Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

8 The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N

9 Step One: Transcription
DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different?? New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

10 Step One: Transcription
Watch this simplified animation: Transcription Animation

11 TACGCATGACTAGCAAGTCTAACT
Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

12 TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA
Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

13 Step 1½: RNA Editing An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.

14 Step 1½: RNA Editing DNA pre-RNA (in nucleus) RNA (in cytoplasm)
transcription exon 1 interon exon 2 exon 3 pre-RNA (in nucleus) interon RNA editing exon 1 exon 2 exon 3 RNA (in cytoplasm)

15 Step Two: Translation Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the mRNA sequence translate into an amino acid sequence?

16 Step Two: Translation Problem: There are 20 different amino acids.
There are 4 RNA bases. A T C G phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly

17 Step Two: Translation Watch this simplified animation:
Translation Animation

18 AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Step Two: Translation So how do you exactly go about determining what protein your cells are going to make? FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

19 Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

20 The Genetic Code

21 Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? met

22 The Genetic Code

23 Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg thr asp arg ser asp ???

24 The Genetic Code

25 Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met met thr asp arg ser asp STOP

26 RECAP: DNA is transcribed into mRNA in the nucleus.
The mRNA leaves the nucleus and enters the cytoplasm. The protein is translated from the mRNA sequence using tRNA and amino acids.

Download ppt "Transcription, Translation & Protein Synthesis"

Similar presentations

RNA and Protein Synthesis

RNA and Protein Synthesis
Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.
Protein Synthesis: Transcription

Protein Synthesis: Transcription
Transcription.

Transcription.
Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.

Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
Section 11-2 From DNA to Proteins.  Enzymes control all the chemical reactions of an organism  Thus, by encoding the instructions form making proteins,

Section 11-2 From DNA to Proteins.  Enzymes control all the chemical reactions of an organism  Thus, by encoding the instructions form making proteins,
RNA & Protein Synthesis.

RNA & Protein Synthesis.
RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.
B IOLOGY : T HURSDAY, J ANUARY 10 TH Today’s Tasks: DNA Replication Review Transcription Notes Round Robin Practice Remember to turn in you nucleic acids.

B IOLOGY : T HURSDAY, J ANUARY 10 TH Today’s Tasks: DNA Replication Review Transcription Notes Round Robin Practice Remember to turn in you nucleic acids.
RNA and Protein Synthesis

RNA and Protein Synthesis
12-3 RNA and Protein Synthesis

12-3 RNA and Protein Synthesis
Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.

Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.
DNA, RNA, & Protein Synthesis

DNA, RNA, & Protein Synthesis
What is central dogma? From DNA to Protein

What is central dogma? From DNA to Protein
DNA to Protein The processes of DNA transcription and translation.

DNA to Protein The processes of DNA transcription and translation.
Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis - a cell makes protein based on the message contained within its DNA.

Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis - a cell makes protein based on the message contained within its DNA.
Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.
From DNA to RNA Biology. Do you remember what proteins are made of ? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino.

From DNA to RNA Biology. Do you remember what proteins are made of ? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino.

Similar presentations

Ads by Google