Presentation is loading. Please wait.

Presentation is loading. Please wait.

Background for Molecular Biology of Lactase Persistence

Published byMarsha Dean Modified over 6 years ago

Similar presentations

Presentation on theme: "Background for Molecular Biology of Lactase Persistence"— Presentation transcript:

1 Background for Molecular Biology of Lactase Persistence
Eukaryotes perform combinatorial control of gene expression Multiple regulatory transcription factors “vote” to express a gene The result is spatial (which cell types) and temporal (which stage of development) control of gene expression Regulatory transcription factors bind to DNA sequences that are Near the promoter (promoter proximal) Far away from the promoter (enhancer or silencer) Regulatory transcription factors are activators or repressors Regulatory transcription factors usually have a DNA binding domain and an activation domain There are several families of DNA binding domains Most use an alpha helix to contact the bases in the major groove of DNA DNA binding domains bind to specific DNA sequences, known as binding sites or motifs Motifs are short, usually 8-12 base pairs long Motifs can be degenerate (variations possible) Transcription factors themselves are encoded by genes and subject to gene regulation by other transcription factors (in a gene regulatory network) Variation in binding site sequences can affect transcription factor binding and, thus, expression of the regulated gene

2 LCT enhancer (left) and proximal promoter region (right)
The enhancer is located within intron 13 of the upstream MCM6 gene, over 13,000 base pairs away from the transcription start site. 3 TF binding sites in proximal promoter 5 TF binding sites in enhancer Total of 6 different TFs bind these 8 binding sites Lewinsky et al. (2005) Figure 3A 5’-...GCAATACAGATAAGATAATGTAGCCCCTG...-3’ Underline is Oct-1 binding site Dashed line is overlapping GATA binding site

3 LCT enhancer (left) and proximal promoter region (right)
The enhancer is located within intron 13 of the upstream MCM6 gene, over 13,000 base pairs away from the transcription start site. Lewinsky et al. (2005) Figure 3A The European SNP associated with lactase persistence is at the end of the Oct-1 binding site. 5’-...GCAATACAGATAAGATAATGTAGTCCCTG...-3’ Underline is Oct-1 binding site Dashed line is overlapping GATA binding site

4 6 SNPs are located in or near the Oct-1 binding site in the LCT enhancer region
5’ 3’ Accessed 19 June 2015

5 “Wild type”: 5’-...CAGGGGCTACATTATCTT...-3’
“wild type” and 6 SNP sequences, top strand only shown 3’ 5’ “Wild type”: 5’-...CAGGGGCTACATTATCTT...-3’ rs : 5’-...CAGGGGCTACACTATCTT...-3’ rs : 5’-...CAGGGGCTACCTTATCTT...-3’ rs : 5’-...CAGGGGCTGCATTATCTT...-3’ rs : 5’-...CAGGGACTACATTATCTT...-3’ rs : 5’-...CAGAGGCTACATTATCTT...-3’ rs : 5’-...CACGGGCTACATTATCTT...-3’ Accessed 19 June 2015

6 wt top strand: 5’-...CAGGGGCTACATTATCTT...-3’
“wild type” and 6 SNPs: both strands of DNA shown for each, top strand in black, bottom strand in grey, oriented as shown in NCBI Variation Viewer window wt top strand: 5’-...CAGGGGCTACATTATCTT...-3’ bottom: ’-...GTCCCCGATGTAATAGAA...-5’ rs : 5’-...CAGGGGCTACACTATCTT...-3’ bottom: ’-...GTCCCCGATGTGATAGAA...-5’ rs : 5’-...CAGGGGCTACCTTATCTT...-3’ bottom: ’-...GTCCCCGATGGAATAGAA...-5’ rs : 5’-...CAGGGGCTGCATTATCTT...-3’ bottom: ’-...GTCCCCGACGTAATAGAA...-5’ rs : 5’-...CAGGGACTACATTATCTT...-3’ bottom: ’-...GTCCCTGATGTAATAGAA...-5’ rs : 5’-...CAGAGGCTACATTATCTT...-3’ bottom: ’-...GTCTCCGATGTAATAGAA...-5’ rs : 5’-...CACGGGCTACATTATCTT...-3’ 3’-...GTGCCCGATGTAATAGAA...-5’

7 wt bottom: 3’-...GTCCCCGATGTAATAGAA...-5’
“wild type” and 6 SNPs: bottom strand only shown for each, oriented as shown in NCBI Variation Viewer window wt bottom: 3’-...GTCCCCGATGTAATAGAA...-5’ rs : 3’-...GTCCCCGATGTGATAGAA...-5’ rs : 3’-...GTCCCCGATGGAATAGAA...-5’ rs : 3’-...GTCCCCGACGTAATAGAA...-5’ rs : 3’-...GTCCCTGATGTAATAGAA...-5’ rs : 3’-...GTCTCCGATGTAATAGAA...-5’ rs : 3’-...GTGCCCGATGTAATAGAA...-5’ “wild type” and 6 SNPs: bottom strand only shown for each, oriented as shown in LCT enhancer region/TF binding sites (reversed so 5’ is on left) wt bottom: 5’-...AAGATAATGTAGCCCCTG...-3’ rs : 3’-...AAGATAGTGTAGCCCCTG...-5’ rs : 3’-...AAGATAAGGTAGCCCCTG...-5’ rs : 3’-...AAGATAATGCAGCCCCTG...-5’ rs : 3’-...AAGATAATGTAGTCCCTG...-5’ rs : 3’-...AAGATAATGTAGCCTCTG...-5’ rs : 3’-...AAGATAATGTAGCCCGTG...-5’

8 wt bottom: 5’-...AAGATAATGTAGCCCCTG...-3’
“wild type” and 6 SNPs: bottom strand only shown for each, oriented as shown in LCT enhancer region/TF binding sites (reversed so 5’ is on left) wt bottom: 5’-...AAGATAATGTAGCCCCTG...-3’ rs : 5’-...AAGATAGTGTAGCCCCTG...-3’ rs : 5’-...AAGATAAGGTAGCCCCTG...-3’ G-13915, Kenya rs : 5’-...AAGATAATGCAGCCCCTG...-3’ rs : 5’-...AAGATAATGTAGTCCCTG...-3’ T-13910, Europe rs : 5’-...AAGATAATGTAGCCTCTG...-3’ rs : 5’-...AAGATAATGTAGCCCGTG...-3’ G-13907, Sudan Graphic from original Evo-Ed PowerPoint

9 wt bottom: 5’-...AAGATAATGTAGCCCCTG...-3’
“wild type” and 6 SNPs compared to Oct-1 binding site shown in Lewinsky et al. (2005), Fig. 2A wt bottom: 5’-...AAGATAATGTAGCCCCTG...-3’ rs : 5’-...AAGATAGTGTAGCCCCTG...-3’ rs : 5’-...AAGATAAGGTAGCCCCTG...-3’ G-13915, Kenya rs : 5’-...AAGATAATGCAGCCCCTG...-3’ rs : 5’-...AAGATAATGTAGTCCCTG...-3’ T-13910, Europe rs : 5’-...AAGATAATGTAGCCTCTG...-3’ rs : 5’-...AAGATAATGTAGCCCGTG...-3’ G-13907, Sudan Transfac M000137: NNNRTAATNANNN Oct-1 consensus sequence 5’-GGCAATACAGATAAGATAATGTAGTC-3’ Underline is Oct-1 binding site Dashed line is overlapping GATA binding site DNA logo of Oct-1 binding motif (M000137)

10 MotifMap Database reports 9 different consensus binding sites for Oct-1
“Canonical” M00342 “Non-canonical” M00137 NNNVTAAWNRNNN consensus from Motifmap NNNRTAATNANNN consensus from Transfac

11 8 structures for Oct-1 (POU2F1) in the Protein Data Bank
The POU2F1 protein is 743 amino acids long. It has a homeobox DNA binding domain and a POU-specific DNA binding domain separated by a flexible linker. The POU-specific domain contacts the 5' half of the canonical binding site (ATGCAAAT). The POU homeodomain contacts the 3' half of the canonical binding site (ATGCAAAT). The linker region is not visible in the crystal structure. Since the POU2F1 binding site in the LCT enhancer is noncanonical, we cannot use the crystal structure to understand structurally how the SNPs affect the binding of POU2F1. 1OCT viewed with NCBI Cn3D

12 rs in red >hg19_dna range=chr2: 'pad=0 3'pad=200 strand=+ repeatMasking=none AAAATCAAACATTATACAAATGCAACCTAAGGAGGAGAGTTCCTTTGAGG CCAGGGGCTACATTATCTTATCTGTATTGCCAGCGCAGAGGCCTACTAGT ACATTGTAGGGTCTAAGTACATTTTTCCTGAATGAAAGGTATTAAATGGT AACTTACGTCTTTATGCACTCTATAAACTATGACGTGATCGTCTCCGTCT AACAACTACACTCAAATGCTTACCAAGCTCTTTAAAGGGAAGAATTCCAT GGTCGTATGAGCATTCAACAGTTACATAAAAATGTATTTGCAGTGAATTC TAGTATGTCCCAT

13 Leonardo da Vinci's Madonna and Child (Madonna Litta).
Photograph: State Hermitage Museum, St Petersburg

Download ppt "Background for Molecular Biology of Lactase Persistence"

Similar presentations

Transcriptional regulation in Eukaryotes The regulatory elements of bacterial, yeast, and human genes.

Transcriptional regulation in Eukaryotes The regulatory elements of bacterial, yeast, and human genes.
Control of Gene Expression

Control of Gene Expression
Outline Questions from last lecture? P. 40 questions on Pax6 gene Mechanism of Transcription Activation –Transcription Regulatory elements Comparison between.

Outline Questions from last lecture? P. 40 questions on Pax6 gene Mechanism of Transcription Activation –Transcription Regulatory elements Comparison between.
Synthetic approaches to transcription factor regulation and function Tim Johnstone BIOL1220 Spring 2010.

Synthetic approaches to transcription factor regulation and function Tim Johnstone BIOL1220 Spring 2010.
Regulating Gene Expression Turning Genes On and Off.

Regulating Gene Expression Turning Genes On and Off.
Negative regulatory proteins bind to operator sequences in the DNA and prevent or weaken RNA polymerase binding.

Negative regulatory proteins bind to operator sequences in the DNA and prevent or weaken RNA polymerase binding.
BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.

BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.
The Hardwiring of development: organization and function of genomic regulatory systems Maria I. Arnone and Eric H. Davidson.

The Hardwiring of development: organization and function of genomic regulatory systems Maria I. Arnone and Eric H. Davidson.
Transcriptional Regulation and RNA Processing

Transcriptional Regulation and RNA Processing
Transcription Co-activator Family Proteins

Transcription Co-activator Family Proteins
Molecular genetics of gene expression Mat Halter and Neal Stewart 2014.

Molecular genetics of gene expression Mat Halter and Neal Stewart 2014.
Gene regulation  Two types of genes: 1)Structural genes – encode specific proteins 2)Regulatory genes – control the level of activity of structural genes.

Gene regulation  Two types of genes: 1)Structural genes – encode specific proteins 2)Regulatory genes – control the level of activity of structural genes.
How Genes Are Controlled

How Genes Are Controlled
Controlling the genes Lecture 15 pp 267-280. Gene Expression Nearly all human cells have a nucleus (not red blood cells) Almost all these nucleated cells.

Controlling the genes Lecture 15 pp Gene Expression Nearly all human cells have a nucleus (not red blood cells) Almost all these nucleated cells.
(c) The McGraw-Hill Companies, Inc.

(c) The McGraw-Hill Companies, Inc.
Raven - Johnson - Biology: 6th Ed. - All Rights Reserved - McGraw Hill Companies Control of Gene Expression Copyright © McGraw-Hill Companies Permission.

Raven - Johnson - Biology: 6th Ed. - All Rights Reserved - McGraw Hill Companies Control of Gene Expression Copyright © McGraw-Hill Companies Permission.
Chapter 11 Phage strategies.

Chapter 11 Phage strategies.
6D Gene expression the process by which the heritable information in a gene, the sequence of DNA base pairs, is made into a functional gene product, such.

6D Gene expression the process by which the heritable information in a gene, the sequence of DNA base pairs, is made into a functional gene product, such.
A Biology Primer Part III: Transcription, Translation, and Regulation Vasileios Hatzivassiloglou University of Texas at Dallas.

A Biology Primer Part III: Transcription, Translation, and Regulation Vasileios Hatzivassiloglou University of Texas at Dallas.
Gene Regulation and Expression. Learning Objectives  Describe gene regulation in prokaryotes.  Explain how most eukaryotic genes are regulated.  Relate.

Gene Regulation and Expression. Learning Objectives  Describe gene regulation in prokaryotes.  Explain how most eukaryotic genes are regulated.  Relate.

Similar presentations

Ads by Google