Presentation is loading. Please wait.

Presentation is loading. Please wait.

Recombinant DNA Technology

Published byElmer Heath Modified over 6 years ago

Similar presentations

Presentation on theme: "Recombinant DNA Technology"— Presentation transcript:

1 Recombinant DNA Technology
Ch.13 – Genetics & Biotechnology 13.2 – DNA Technology Recombinant DNA Technology Restriction Enzymes

2 13.2 – DNA Technology Gene Cloning Transgenic Organisms

3 Sorts DNA segments by length
Ch.13 – Genetics & Biotechnology 13.2 – DNA Technology Gel Electrophoresis Sorts DNA segments by length DNA has a slight negative charge, therefore it is attracted to the positive electrode

4 Restrictive enzymes are used to cut DNA at specific sequences.
Ch.13 – Genetics & Biotechnology 13.2 – DNA Technology DNA Fingerprinting Restrictive enzymes are used to cut DNA at specific sequences. Electrophoresis is used to separate the cut DNA into different lengths. Individuals (not related) show unique patterns in the length of the cut segments of DNA

5 Ch.13 – Genetics & Biotechnology 13.2 – DNA Technology
Large segments Small segments CTGAAGCTTACATGCTGAATTCAACGAGTGTCATGAATTCCGGTATTAGCT AGCTTACATGCTGAATTCAACGAGTGTCATGAATTCCGGTATTAGCT CTGA CTGAGGCTTACATGCTGAATTCAACGAAGCTTTGAATTCATGCCCGTATA CTGAGGCTTACATGCTGAATTCAACGA AGCTTTGAATTCATGCCCGTATA CTGAGGCTTACATGAAGCTTCTGAATTCAACGTAAGCTTGAATTCATGCCGCT AGCTTCTGAATTCAACGTA AGCTTGAATTCATGCCGCT CTGAGGCTTACATGA

6 DNA Sequencing Ch.13 – Genetics & Biotechnology 13.2 – DNA Technology
The tagged nucleotides cause base pairing to stop creating different sized-molecules that end with the base that is tagged

7 Polymerase Chain Reaction (PCR)
Ch.13 – Genetics & Biotechnology 13.2 – DNA Technology Polymerase Chain Reaction (PCR)

Download ppt "Recombinant DNA Technology"

Similar presentations

C rime S cene I nvestigation. Who Ate The Cheese? Oh no! Someone ate the Queen ’ s prize Limburger cheese! Saliva samples were taken from the teeth marks.

C rime S cene I nvestigation. Who Ate The Cheese? Oh no! Someone ate the Queen ’ s prize Limburger cheese! Saliva samples were taken from the teeth marks.
Biotechnology Overview

Biotechnology Overview
(RFLP Electrophoresis)

(RFLP Electrophoresis)
Warm Up Create a Vocabulary 4 Square As we identify the terms in our lesson: 1.Define the term 2. Give an example 3. Draw a picture to help you remember.

Warm Up Create a Vocabulary 4 Square As we identify the terms in our lesson: 1.Define the term 2. Give an example 3. Draw a picture to help you remember.
DNA Technology n Now it gets real….. O.J. Simpson capital murder case,1/95-9/95 Odds of blood on socks in bedroom not being N. Brown-Simpson’s: 8.5 billion.

DNA Technology n Now it gets real….. O.J. Simpson capital murder case,1/95-9/95 Odds of blood on socks in bedroom not being N. Brown-Simpson’s: 8.5 billion.
Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:

Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:
Biotechnology. Comparative genomics also has been used to identify recently mobilized transposons in genetically diverse humans. For example, over 600.

Biotechnology. Comparative genomics also has been used to identify recently mobilized transposons in genetically diverse humans. For example, over 600.
Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu DNA Identification The repeating sequences in noncoding DNA vary.

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu DNA Identification The repeating sequences in noncoding DNA vary.
Unit 8 test Biotech study guide.

Unit 8 test Biotech study guide.
Ch. 13.4: DNA Technology Applications

Ch. 13.4: DNA Technology Applications
5 10 15 20 25 The Clone Age Human Genome Project Recombinant DNA Gel Electrophoresis DNA fingerprints 5 10 15 20 25 5 10 15 20 25 5 10 15 20 25 5 10 15.

The Clone Age Human Genome Project Recombinant DNA Gel Electrophoresis DNA fingerprints
Biotechnology Technology involving the DNA, genes, and, proteins of different organisms. (Chapter 9) DNA Fingerprinting w/ Gel Electrophoresis Selective.

Biotechnology Technology involving the DNA, genes, and, proteins of different organisms. (Chapter 9) DNA Fingerprinting w/ Gel Electrophoresis Selective.
Pre – AP Biology DNA Biotechnology (4.4) Part 1. Cloning & Genetic recombination.

Pre – AP Biology DNA Biotechnology (4.4) Part 1. Cloning & Genetic recombination.
Technological Solutions. In 1977 Sanger et al. were able to work out the complete nucleotide sequence in a virus – (Phage 0X174) This breakthrough allowed.

Technological Solutions. In 1977 Sanger et al. were able to work out the complete nucleotide sequence in a virus – (Phage 0X174) This breakthrough allowed.
Genetic Engineering. What is genetic engineering? Application of molecular genetics for practical purposes Used to – identify genes for specific traits.

Genetic Engineering. What is genetic engineering? Application of molecular genetics for practical purposes Used to – identify genes for specific traits.
Class Notes 1: DNA Manipulation. I. DNA manipulation A. During recent years, scientists have developed a technique to manipulate DNA, enabling them to.

Class Notes 1: DNA Manipulation. I. DNA manipulation A. During recent years, scientists have developed a technique to manipulate DNA, enabling them to.
Electrophoresis. A process that is used to sort fragments of DNA by placing the digested DNA in a special gel and adding electricity.

Electrophoresis. A process that is used to sort fragments of DNA by placing the digested DNA in a special gel and adding electricity.
Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.

Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.
DNA Technology Chapter 12. Transgenic Organisms Contain recombinant DNA – Nucleotide sequences from 2+ different sources Cells express original AND newly.

DNA Technology Chapter 12. Transgenic Organisms Contain recombinant DNA – Nucleotide sequences from 2+ different sources Cells express original AND newly.
Making human insulin from bacteria: Use a restriction enzyme to cut out the gene for insulin a genetic scissors which cuts DNA at a specific sequence of.

Making human insulin from bacteria: Use a restriction enzyme to cut out the gene for insulin a genetic scissors which cuts DNA at a specific sequence of.

Similar presentations

Ads by Google