Download presentation
Presentation is loading. Please wait.
1
Chapter 17: From Gene to Protein
2
What do genes code for? How does DNA code for cells & bodies?
how are cells and bodies made from the instructions in DNA All the traits of the body DNA proteins
3
transcription and translation
The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation replication
4
DNA RNA RNA Monomers = nucleotides Phosphate Ribose sugar
Nitrogen Bases uracil instead of thymine U bonds with A C bonds with G single stranded transcription DNA RNA
5
Allowed to travel from nucleus to cytoplasm
Compare DNA and RNA DNA RNA Shape Double helix 2 strands Single strand Sugar Deoxyribose Ribose Bases A, T, C, and G A, U, C and G Location Only in the nucleus Allowed to travel from nucleus to cytoplasm
6
Types of RNA Ribosomal RNA (rRNA) Transfer RNA (tRNA)
Major component of ribosomes Transfer RNA (tRNA) Folded upon itself Carries the amino acids to the mRNA Messenger RNA (mRNA) Sequence of nucleotides that determines the primary sequence of the polypeptide Made in the nucleus from the DNA: transcription snRNA (small-nuclear “snurps”) Forms the “spliceosomes” which are used to cut out introns from pre-mRNA siRNA (small-interfering) targets specific mRNA and prohibits it from being expressed
7
Protein Synthesis: From gene to protein
aa a nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait
8
Which gene is read on the DNA?
Promoter region binding site before beginning of gene Generally referred to as a TATA box because it is a repeating sequence of T and A binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene Speeds up process
9
Transcription Factors
transcription factors bind to promoter region of DNA proteins can be activated by hormones (cell signaling) turn on or off transcription triggers the binding of RNA polymerase to DNA
10
Transcription: DNA to mRNA
Takes place in the nucleus A section of DNA is unzipped RNA polymerase lays down nucleotides 5’ to 3’ direction. The mRNA then leaves the nucleus through the nuclear pores and enters the cytoplasm
11
Coding strand = this is the protein needed or “sense strand”
Template strand = this is the “anti-sense strand”
12
Eukaryotic genes have untranscribed regions!
mRNA must be modified before it leaves the nucleus exons = the real gene expressed / coding DNA introns = non-coded section in-between sequence Spliceosomes cut out introns with ribozyme introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
13
Starting to get hard to define a gene!
Alternative splicing Same piece of DNA can be read many different Not all the exons may make it to the final product Intron presence can determine which exons stay or go Increases efficiency and flexibility of cell snRNA’s have big role in alternative splicing Starting to get hard to define a gene!
14
Final mRNA processing…
Need to protect mRNA on its trip from nucleus to cytoplasm (enzymes in cytoplasm attack mRNA) protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P A’s
15
The Transcriptional unit
enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start introns transcription stop promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA
16
Genetic Code Genetic code is based on sets of 3 nucleotides …called CODONS! Read from the mRNA 64 different possible combinations exist Only 20 amino acids commonly exist in the human body Some codons code for the same amino acids (degenerate or redundant) Sequence of codons determines the sequence of the polypeptide Code is “almost” universal…same for all organisms (evolutionary heritage)
17
The Code You don’t need to memorize the codons (except for AUG)
Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.
18
mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ? MetArgValAsnAlaCysAla protein
19
How is the code “translated?”
Process of reading mRNA and creating a protein chain from the code.
20
Ribosomes: Site of Protein Synthesis
Facilitate coupling of tRNA anticodon to mRNA codon Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A
21
Ribosomes: 3 binding sites
A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) Empty tRNA leaves ribosome from exit site Met 5' U A C A U G
22
Transfer RNA Found in cytoplasm Carries amino acids to ribosome
Contains an “anticodon” of nitrogen bases Anticodons use complementary bond with codons Less tRNA’s than codons, so one tRNA may bind with more than one codon. Supports the degenerate code “Wobble” hypothesis: anticodon with U in third position can bind to A or G
23
Translation: mRNA to Protein
In the cytoplasm ribosomes attach to the mRNA Ribosome covers 3 codons at a time Initiation - The tRNA carrying an amino acid comes into P-site and bonds by base pairing its anti-codon with the mRNA start codon (what is the start codon?) Elongation – The second tRNA then comes into A-site and bonds to codon of mRNA The two amino acids joined with peptide bond Termination – ribosome continues reading mRNA until a STOP codon is reached (doesn’t code for anything) McGraw Hill Animations
24
Building a polypeptide
1 2 3 Initiation mRNA, ribosome subunits, initiator tRNA come together Elongation adding amino acids based on codons Termination STOP codon = Release factor Good Overview animation Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G C U A C 5' U A C G A C U A C G A C G A C 5' A 5' U A A U G C U G A U A U G C U G A A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'
25
Can you tell the story? exon intron 5' GTP cap poly-A tail
RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal subunit E P A ribosome
26
Prokaryote vs. Eukaryote Differences
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns No splicing Promoter & terminator sequence Smaller ribosomes Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns and exons TATA box promoter Transcription factors present Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise.
27
Protein Synthesis in Prokaryotes
Transcription & translation are simultaneous in bacteria Both occur in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed
28
Mutations
29
When do mutations affect the next generation?
Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid Changes the final protein nonsense change to stop codon Stopping prematurely When do mutations affect the next generation?
30
Point mutation lead to Sickle cell anemia
What kind of mutation? What structure has the mutation? RNA or DNA
31
Mutations Frameshift shift in the reading frame
changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?
Similar presentations
