1. Microbial Taxonomy and the Evolution of Diversity
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Chapter 17
Microbial Taxonomy and the Evolution of Diversity

2. Introduction to Microbial Taxonomy
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Introduction to Microbial Taxonomy
taxonomy
science of biological classification
consists of three separate but interrelated parts
classification – arrangement of organisms into groups (taxa; s., taxon)
nomenclature – assignment of names to taxa
identification – determination of taxon to which an isolate belongs

3. Natural Classification
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Natural Classification
arranges organisms into groups whose members share many characteristics
first such classification in 18th century developed by Linnaeus
based on anatomical characteristics
this approach to classification does not necessarily provide information on evolutionary relatedness

4. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Polyphasic Taxonomy
used to determine the genus and species of a newly discovered prokaryote
incorporates information from genetic, phenotypic, and phylogenetic analysis

5. Phenetic Classification
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Phenetic Classification
groups organisms together based on mutual similarity of phenotypes
can reveal evolutionary relationships, but not dependent on phylogenetic analysis
i.e., doesn’t weigh characters
best systems compare as many attributes as possible

6. Phylogenetic Classification
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Phylogenetic Classification
also called phyletic classification systems
phylogeny
evolutionary development of a species
usually based on direct comparison of genetic material and gene products
Woese and Fox proposed using small subunit (SSU) rRNA nucleotide sequences to assess evolutionary relatedness of organisms

7. Genotypic Classification
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Genotypic Classification
comparison of genetic similarity between organisms
individual genes or whole genomes can be compared
70% homologous belong to the same species

8. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Taxonomic Ranks - 1
microbes are placed in hierarchical taxonomic levels with each level or rank sharing a common set of specific features
highest rank is domain
Bacteria and Archaea – microbes only
Eukarya – microbes and macroorganisms
within domain
phylum, class, order, family, genus, species epithet, some microbes have subspecies

9. Figure 17.1;Hierarchical arrangement in taxonomy
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Figure 17.1;Hierarchical arrangement in taxonomy

10. Species definition also suggested as a definition of species
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Species
definition
collection of strains that share many stable properties and differ significantly from other groups of strains
also suggested as a definition of species
collection of organisms that share the same sequences in their core housekeeping genes

11. Strains descended from a single, pure microbial culture
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Strains
descended from a single, pure microbial culture
vary from each other in many ways
biovars – differ biochemically and physiologically
morphovars – differ morphologically
serovars – differ in antigenic properties

12. Type Strain usually one of first strains of a species studied
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Type Strain
usually one of first strains of a species studied
often most fully characterized
not necessarily most representative member of species

13. Genus well-defined group of one or more strains
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Genus
well-defined group of one or more strains
clearly separate from other genera
often disagreement among taxonomists about the assignment of a specific species to a genus

14. Figure 17.1;Hierarchical arrangement in taxonomy
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Figure 17.1;Hierarchical arrangement in taxonomy

15. Binomial System of Nomenclature
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Binomial System of Nomenclature
devised by Carl von Linné (Carolus Linnaeus)
each organism has two names
genus name – italicized and capitalized (e.g., Escherichia)
species epithet – italicized but not capitalized (e.g., coli)
can be abbreviated after first use (e.g., E. coli)
a new species cannot be recognized until it has been published in the International Journal of Systematic and Evolutionary Microbiology

16. Techniques for Determining Microbial Taxonomy and Phylogeny
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Techniques for Determining Microbial Taxonomy and Phylogeny
classical characteristics
morphological
physiological
biochemical
ecological
genetic

17. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

18. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

19. Ecological Characteristics
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Ecological Characteristics
life-cycle patterns
symbiotic relationships
ability to cause disease (virulence)
habitat preferences
growth requirements

20. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Molecular Approaches
extremely important because almost no fossil record was left by microbes
allows for the collection of a large and accurate data set from many organisms
phylogenetic inferences based on these provide the best analysis of microbial evolution currently available

21. Molecular Characteristics
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Molecular Characteristics
nucleic acid base composition
nucleic acid hybridization
nucleic acid sequencing
genomic fingerprinting
amino acid sequencing

22. Nucleic Acid Base Composition
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Nucleic Acid Base Composition
G + C content
Mol% G + C =
(G + C/G + C + A + T)100
usually determined from melting temperature (Tm); G-C has 3 H bonds while A-T has 2 H bonds.
variation within a genus usually <10%

23. Figure 17.2; DNA melting curve
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Figure 17.2; DNA melting curve

24. Nucleic Acid Hybridization
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Nucleic Acid Hybridization
DNA-DNA hybridization
measure of sequence homology
common procedure
bind nonradioactive DNA to nitrocellulose filter
incubate filter with radioactive single-stranded DNA
measure amount of radioactive DNA attached to filter (measures hybridization)

25. DNA-DNA Hybridization
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
DNA-DNA Hybridization

26. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

27. Nucleic acid sequencing
Most powerful and direct method for comparing genomes
Sequences of ribosomal rRNA (rDNA) from small ribosomal subunits (16S and 18S rRNA), which are called SSU rRNAs for short are used most often in phylogenetic studies.
These SSU rRNA are ideal for studies of microbial phylogeny and relatedness as they play the same role in all microorganisms and because the ribosomes can not tolerate large mutations . Thus these genes change very slowly with time and are NOT subjected to horizontal gene transfer.
rRNA is amplified by using special primers by PCR and then sequenced.
Complete chromosomes can now be sequenced and compared
See: Jaradat et al. BMC Microbiol Oct 27;9:225. doi: /

28. Comparative Analysis of 16S rRNA sequences
Comparative analysis of 16S rRNA sequences from thousands of microorganisms demonstrated the presence of oligonucleotide signature sequences which are;
short conserved sequences specific for a phylogenetically defined group of organisms
Either complete or, more often, specific rRNA fragments can be compared.
When comparing rRNA sequences between 2 organisms, their relatedness is represented by an association coefficient (Sab value).
the higher the Sab value, the more closely related the organisms with an Sab vaule of one means identical organisms.
70% is cutoff value for species definition is used

29. Figure 17.3; secondary structure of rRNA form three domains
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Figure 17.3; secondary structure of rRNA form three domains

30. Genomic Fingerprinting
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Genomic Fingerprinting
used for microbial classification and determination of phylogenetic relationships
requires analysis of genes that evolve more quickly than rRNA encoding genes
multilocus sequence analysis (MSLA)
the sequencing and comparison of 5 to 7 housekeeping genes is done to prevent misleading results from analysis of one gene
multilocus sequence typing (MLST) –
discriminates among strains

31. Figure 17.4; genome finger printing based on nucleotide sequences
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Figure 17.4; genome finger printing based on nucleotide sequences

32. Restriction Fragment Length Polymorphism (RFLP)
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Restriction Fragment Length Polymorphism (RFLP)
uses restriction enzymes to recognize specific nucleotide sequences
cleavage patterns are compared using specific software
ribotyping
similarity between rRNA genes is determined by RFLP rather than sequencing
It does not require nucleotide sequencing, instead uses restriction enzymes to recognize specific nucleotide sequences
cleavage patterns are compared.
The comparison of restriction fragments between species and strains is the basis of Restriction Fragment Length Polymorphism (RFLP) analysis. See the following 2 figs.

33. GGAATTTCCCCAGGGGGAATTT TTAACCCAAATGTTTCCCCAAATTTCCCCGGGATCG
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
AAAATTTCCCCAGGATGC
GGAATTTCCCCAGGGGGAATTT
TTAACCCAAATGTTTCCCCAAATTTCCCCGGGATCG

35. RFLP of coagulase gene

36. Single Nucleotide Polymorphism (SNP)
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Single Nucleotide Polymorphism (SNP)
Looks at single nucleotide changes, or polymorphisms, in specific genes (the enzyme cuts or not based on the presence of the target SNP.
16S rRNA focuses on one specific gene
Regions targeted because they are normally conserved, so single changes in a base pair reveal evolutionary change

37. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Amino Acid Sequencing
amino acid sequences reflect mRNA sequence and therefore of the gene which encodes that protein
amino acid sequencing of proteins such as cytochromes, histones, and heat-shock proteins has provided relevant taxonomic and phylogenetic information
cannot be used for all proteins because sequences of proteins with different functions often change at different rates

38. Copyright © The McGraw-Hill Companies, Inc
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Figure 17.6