How can we use DNA to help humans?

How can we use DNA to help humans?
BIOTECHNOLOGY p. 83 in Handbook

DNA Fingerprinting Each individual (except clones and identical twins) has a unique DNA sequence. This sequence can be used to produce a DNA fingerprint, a unique band pattern of DNA fragments.

Fill It In … Compare a DNA fingerprint with a typical fingerprint:

DNA Fingerprinting A DNA fingerprint is produced using a gel electrophoresis. A gel electrophoresis is a machine that separates pieces of DNA based on size (the number of base pairs)

DNA Fingerprinting The process of producing a DNA fingerprint can be described in three basic steps: 1. A restriction enzyme is used to cut the DNA sample into pieces. A restriction enzyme binds to a specific sequence of DNA bases, called a restriction site, and cuts (cleaves) the DNA between two of the bases in that site. This produces many pieces of different sizes.

DNA Fingerprinting The process of producing a DNA fingerprint can be described in three basic steps: 2. Once the restriction enzymes have recognized all the restriction sites and have cleaved the DNA into pieces, the sample is loaded into a gel for electrophoresis.

DNA Fingerprinting The process of producing a DNA fingerprint can be described in three basic steps: Electricity forces the DNA pieces to move through the gel. Smaller pieces are able to move farther than larger pieces. The electrophoresis creates a separation of pieces by size - making a column of bands.

Gel electrophoresis – +
A method of separating DNA in a gelatin-like material using an electrical field DNA is negatively charged when it’s in an electrical field it moves toward the positive side DNA        – + “swimming through Jello”

DNA Fingerprinting The process of producing a DNA fingerprint can be described in three basic steps: 3. The DNA sequence of different individuals will have different numbers of restriction sites, or restriction sites in slightly different places. The variation of restriction sites means that an individual’s band pattern will likely be different from other individuals.

DNA fingerprint Why is each person’s DNA pattern different?
sections of “junk” DNA doesn’t code for proteins made up of repeated patterns CAT, GCC, and others each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

DNA Fingerprinting The process of producing a DNA fingerprint can be described in three basic steps: 3. By comparing band patterns, we can determine many things.

Uses: Forensics Comparing DNA sample from crime scene with suspects & victim suspects crime scene sample S1 S2 S3 V – DNA  +

Fill It In … Find ONE WORD that describes each of the three steps of making a DNA fingerprint. A hint is given! Write the word below: C_______ E_______

DNA fingerprints can be used for several applications
A DNA Fingerprint can be used for several reasons. A DNA fingerprint can be used to identify an individual, or determine the source of DNA left at a crime scene. Example: a bloody knife was found a short distance from a murder victim. Two suspects have been identified” Blood on Knife Victim Suspect A Suspect B ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____

Explanation: the blood on the knife came from two sources - the victim and another person (we can eliminate the bands of the victim, but other bands remain). By comparing the remaining bands, it is clear that Suspect A is cleared, and Suspect B is …. suspect Blood on Knife Victim Suspect A Suspect B ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____

Fill It In … Highlight the shortest piece of DNA in this fingerprint.
Blood on Knife Victim Suspect A Suspect B ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ What tool/process was used to create this fingerprint?

Electrophoresis use in forensics
Evidence from murder trial Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard”

A DNA Fingerprint can be used to determine the paternity of a child.

Uses: Paternity Who’s the father? – Mom F1 F2 child DNA  +

Example: a millionaire has been charged with several paternity cases. His lawyer ordered DNA Fingerprints: Richy Rich Mother A Child A Mother B Child B Mother C Child C _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ ____ _____ _____ _____ _____ _____ _____

Explanation: because half of your DNA is inherited from your mother and half from your father, each band in a child’s patter will also appear in either the pattern of the mother or of the father. Richy Rich Mother A Child A Mother B Child B Mother C Child C _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____

Explanation: Child A could NOT be Richy Rich’s child because of the third band in the child’s pattern. Child C could NOT be Richy Rich’s child based on the third band in the child’s pattern. Child B COULD be Richy Rich’s child. Richy Rich Mother A Child A Mother B Child B Mother C Child C _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____

Fill It In … How is analyzing a DNA fingerprint for paternity DIFFERENT than analyzing a fingerprint to identify an individual’s DNA from a crime scene?

Uses: Evolutionary relationships
Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – 1 3 2 4 5 1 2 3 4 5 DNA  +

DNA fingerprinting can be used to catalog endangered species. For example, researchers have developed DNA banks of endangered species protected by law. This allows them to prove if endangered species are used in products, such as medicines or food.

Check Yourself! What is a DNA Fingerprint?
What technology is used to make a DNA Fingerprint? What type of enzymes are used to cut DNA? What are three uses for DNA fingerprinting?

Check Yourself! What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS What technology is used to make a DNA Fingerprint? What type of enzymes are used to cut DNA? What are three uses for DNA fingerprinting?

Check Yourself! What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS What technology is used to make a DNA Fingerprint? GEL ELECTROPHORESIS What type of enzymes are used to cut DNA? What are three uses for DNA fingerprinting?

Check Yourself! What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS What technology is used to make a DNA Fingerprint? GEL ELECTROPHORESIS What type of enzymes are used to cut DNA? RESTRICTION ENZYMES What are three uses for DNA fingerprinting?

Check Yourself! What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS What technology is used to make a DNA Fingerprint? GEL ELECTROPHORESIS What type of enzymes are used to cut DNA? RESTRICTION ENZYMES What are three uses for DNA fingerprinting? CRIME SCENE INVESTIGATION DETERMINING PATERNITY CATALOG ENDANGERED SPECIES

Who Stole the Lollypop? Who Stole the Lollypop? A Link for the Missing
DNA Fingerprint Lab – turn it in DNA Fingerprint Practice

Genetic Engineering Video: Genetic Modification (PBS Learning Media)

Genetic Engineering p. 87 Genetic engineering is the modification of DNA. Modification means changing, such as adding or removing parts of the DNA sequence.

Genetic Engineering Genetic engineering may be used to produce a transgenic organism (an organism which contains foreign DNA) to use in gene therapy or gene cloning.

Fill It In … WORD HELP! “trans” means to __________ “genic” means ___________

Genetic engineering can be used for several applications
Genetic engineering can be used to create a transgenic organism

Restriction enzymes are used to cleave the foreign DNA source in order to isolate the desired gene. For example, removing the insulin gene from human DNA

The same restriction enzyme is used to cleave the vector (which may be a bacterial plasmid). A vector is the structure used to carry the foreign DNA.

The foreign DNA fragment (the desired gene) and the vector are combined/spliced together.

The combination is possible for two reasons. First, DNA is similar in all organisms. Second, the same restriction enzyme is used on both samples of DNA

The combined DNA (called recombinant DNA) is inserted into the host (which may be a bacteria cell) The host cell will copy/clone the recombinant DNA as it reproduces and will produce the protein (such as insulin) from the desired gene during protein synthesis.

Fill It In … How are each of the words related to genetic engineering?
Vector - Recombinant DNA - Host cell -

Fill It In … Find ONE WORD that completes the short description of each of the four steps. A hint is given! Write the word below: C_________ DNA V_________ opened C_________ together I__________ into host

Weird Science! 5 percent of U.S. corn and 85 percent of U.S. soybeans are genetically engineered, and it’s estimated that 70 to 75 percent of processed foods on grocery store

Glow in the dark cats

Enviropig Digest and process phosphorus

Pollution- fighting plants
Absorb and clean soil through their roots

Venomous Cabbage Scorpion Venom to kill caterpillars but not harmful to humans

Web Spinning Goats Silk protein in their milk

Fast Growing Samon

Flavr Savr Tomato Slow ripening time

Vaccine Banana People may soon be getting vaccinated for diseases like hepatitis B and cholera by simply taking a bite of banana. Researchers have successfully engineered bananas, potatoes, lettuce, carrots and tobacco to produce vaccines

Less-flatulent cows Cows produce significant amounts of methane as a result of their digestion process — it’s produced by a bacterium that’s a byproduct of cows’ high-cellulosic diets that include grass and hay

GM Trees! Grow Faster Freezing temperatures,
Loblolly pines have been created with less lignin, the substance that gives trees their rigidity. In 2003, the Pentagon even awarded Colorado State researchers $500,000 to develop pine trees that change color when exposed to biological or chemical attack.

Medicine Eggs British scientists have created a breed of genetically modified hens that produce cancer-fighting medicines in their eggs. The animals have had human genes added to their DNA so that human proteins are secreted into the whites of their eggs, along with complex medicinal proteins similar to drugs used to treat skin cancer and other diseases

Super carbon-capturing plants
Absorb more carbon dioxide

Genetic engineering may be used for gene therapy.

Gene therapy has been used to treat Severe Combined Immunodeficiency (SCID) and cystic fibrosis (CF). It has been shown to be safe for up to 10 years to treat SCID, but patients have the risk of developing leukemia

Gene therapy has been used to treat Severe Combined Immunodeficiency (SCID) and cystic fibrosis (CF). In treating cystic fibrosis, the results hav been limited because the patient’s immune system is fighting off the virus used to carry the correct gene to the target cells.

Defective genes are identified within the DNA sequence. Individuals may be tested for the presence of the defective gene (for example, the IL2RG gene in SCIDS)

A functioning gene isolated from a donor’s DNA is “packaged” into a vector/carrier (such as a cold virus used for CF gene therapy)

The vector is introduced to the organism with the defective gene. The functioning gene is delivered to target cells and randomly inserts itself into the DNA (this is what likely caused the leukemia in the SCID treatment). Now the cell can produce the correct protein.

Genetic engineering has many practical purposes
Medical applications include producing large quantities of human proteins (such as insulin and human growth hormone) cheaply and providing animal models of human genetic diseases (such as knock-out mice) Genetic Engineering

Agricultural applications include producing plants that are herbicide or pest resistant and plants that have higher nutritional value. These plants are commonly called GMOs (genetically-modified organisms)

Industrial uses include using mircoorganisms to clean up mining waste, sewage treatment, and environmental disasters.

Genetic engineering raises serious bioethical concerns
The question may need to be “Should we?” instead of “Could we?” For example, should we alter the natural variation of human genes by genetic engineering?

Creating plants with new genes may trigger allergic reactions in unsuspecting consumers. For example, a gene from a peanut plant to a corn plant in order to increase nutrition may cause an allergic reaction in some people.

Creating organisms that are not naturally occurring may create problems in the environment or for humans. For example, an oil digesting bacteria may get into oil-digesting bacteria may get into oil-based machinery and our oil supplies.

Check Yourself! What is genetic engineering?
What is a transgenic organism? How are restriction enzymes used in genetic engineering? What is gene therapy? List two practical applications of genetic engineering.

Check Yourself! What is genetic engineering? THE MODIFICATION OF DNA
What is a transgenic organism? How are restriction enzymes used in genetic engineering? What is gene therapy? List two practical applications of genetic engineering.

What is a transgenic organism? AN ORGANISM CONTAINING FOREIGN DNA How are restriction enzymes used in genetic engineering? CLEAVE/CUT DNA AT A SPECIFIC NUCLEOTIDE SEQUENCE What is gene therapy? List two practical applications of genetic engineering.

What is a transgenic organism? AN ORGANISM CONTAINING FOREIGN DNA How are restriction enzymes used in genetic engineering? CLEAVE/CUT DNA AT A SPECIFIC NUCLEOTIDE SEQUENCE What is gene therapy? A TECHNIQUE THAT USES GENES TO TREAT OR PREVENT DISEASES/DISORDERS List two practical applications of genetic engineering.

What is a transgenic organism? AN ORGANISM CONTAINING FOREIGN DNA How are restriction enzymes used in genetic engineering? CLEAVE/CUT DNA AT A SPECIFIC NUCLEOTIDE SEQUENCE What is gene therapy? A TECHNIQUE THAT USES GENES TO TREAT OR PREVENT DISEASES/DISORDERS List two practical applications of genetic engineering. MEDICAL, AGRICULTURAL, INDUSTRIAL

Genetic Engineering Lab
Let’s model/simulate how to create recombinant DNA using bacterial plasmids You need: Scissors Tape (share) 1 Activity sheet 1 pink strip of DNA 1 blue strip of DNA

Genetic Engineering Activity
Step #1: Cleave Donor DNA (pink strip) Step #2: CLEAVE PLASMID (blue strip) Step #3: PRODUCE RECOMBINANT DNA. Step #4: CLONE CELLS. Step #5: SCREEN CELLS.

Warm-up Answer 1-4 under “Genetic Engineering Checkpoint”
Papers will be returned. Put the following in your portfolio: Disease Brochure and Rubric CE #3 and #4 HGP Article + Questions

Summarizing Recombinant DNA
Answer 1-7 at the bottom on your own. WHEN YOU FINISH, check/compare answers with someone near you. Turn it over and do the back side!

Genetically Modified Foods
A Close Reading Read the article silently to yourself. As you read, use the following annotations: Highlight = important/key ideas (any color) Blue ! = things that are interesting or surprising Red ? = things you have a question about

Genetically Modified Foods
With those in your group… Share out your key points/main ideas Make a list of 2-3 main/key ideas on the index card Share out your surprising/interesting facts Write 1 or 2 interesting/surprising things you learned on sticky notes (be ready to share with class) Share out your questions Write 1 or 2 questions you had from reading the article on sticky notes (be ready to share with class)

How can we use DNA to help humans?

Similar presentations

Presentation on theme: "How can we use DNA to help humans?"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

How can we use DNA to help humans?

Similar presentations

Presentation on theme: "How can we use DNA to help humans?"— Presentation transcript:

Similar presentations

About project

Feedback