1. cDNA-Project
cDNA project
Julia Brettschneider
(UCB Statistics)

2. cDNA
project

3. Biological question
What are the underlying molecular cascades that are activated following brain injury and lead the cells into and through cell death?

4. Experiments Platform: Incyte mouse cDNA arrays
Twelve cDNA dye swap pairs
9024 genes total
4 print-tip groups (48 x 47 spots each)
Controls: The last 24 spots in each print-tip group

5. Find differentially expressed genes…
injured (i) vs. sham (s)
hypocamp. subfield CA3 (C) vs. upper blade Dentate (D)
between different marker status (+,>,-) would also be interesting…

6. The 24 comparisons #01 iC+ sC- #02 iC- sC- #03 iD+ sD- #04 iD- sD-
#05 iC+ iC-
#06 iD+ iD-
#07 sC- iC+
#08 iC- iC+
#09 sC- iC-
#10 sD- iD+
#11 iD- iD+
#12 sD- iD-
#13 iC+ iC>
#14 iC> iC-
#15 iC> sC-
#16 iD+ iD>
#17 iD> iD-
#18 iD> sD-
#19 iC> iC+
#20 iC- iC>
#21 sC- iC>
#22 iD> iD+
#2C iD> iD-
#24 sD- iD>

7. Dye swap pair (injured +) vs (sham -)

8. Dye swap pairs (injured >) vs (sham -)

9. Incyte’s Flags Between 22% and 91% of the genes flagged,
in 15 chips more than 50%,
in 8 chips more than 75%.
Incyte’s criterion for flagging:
- signal to bg ratio smaller than 2.5, or
- spot area smaller than 40% in both dyes
Flagged genes are not used in normalization

11. Problems Design (regions CA3 and dentate never hybridized together)
“Flagged genes”
Low quality chips
Inconsistent dye swap pairs
Normalization

12. Image analysis and normalization
Image analysis using “Spot”
(Yang, Buckley, and Speed 1999,
Program written by CSIRO Mathematics and Information Science)
Lowess normalization (Dudoit et al. 2000) for print-tip groups

25. Summary cDNA project Image analysis redone Normalization
Gene rank lists

26. Affymetrix
Technoloy
Statistics
Drosophila project

27. Technology of oligonucleotide arrays
Each gene is interrogated by a number ( ) of probe pairs
Each probe pair consists of two oligonucleotides (typically 25 bp long):
Perfect Match (PM) fits the target exactly
Missmatch (MM) has a middle base flipped

28. Chip
Probes PM MM

29. PM MM
…TGCTGGGTTACGCAGTCTTACTGACCATACACGCACTGCT…
PM: AATGCGTCAGAATGACTGGTATGTGCGTCACGA
MM: AATGCGTCAGAAAGACTGGTATGTGCGTCACGA ^
missmatch position

30. Steps in the analysis Converting .cel file into probe pair data
Normalization
Calculation of an expression value for each gene based on the intensities of its 20 probe pairs
Comparing treatment/control, WT/mutant etc.
Hypothesis testing
Clustering
etc.

31. Gene expression estimation
Genechip (Affymetrix):
Average difference between the probe pairs
Average log ratio
Now: robust/resistent version

32. Gene expression estimation
Li and Wong (2000) fit a model
expression in chip i
(j probe pair index)

33. Gene expression estimation
Irizarry, Speed et al. (2002):
Average log (PM - BG),
where BG global background
Now: robust version using median polish

34. Example Scatters

37. Mixture Model fits

38. Fits for significant genes

39. Significance of regression

41. Residual Plots

42. Axon guidance in the Drosophila CNS
How do neurons find their correct targets, make appropriate synaptic connections, and set and adjust their size and strength?
Find genes which regulate these mechanisms by comparing different mutants
Loss Of Function (LOF) and Gain Of Functions (GOF) mutants for a number of proteins

43. Robo, Slit & Comm
Robo: transmembrane protein, receptor for slit, negatively controlled by Comm
Slit: extracellular protein, expressed by midline glia, ligand for Robo receptor
Comm: surface protein, expressd on midline cells, transferred to commissural neurons

44. Phenotypes

46. Experiments 12 (plus…) different mutants, plus WT
4 replicates for each
Affymetrix Drosophila chips
about 13 thousand genes in total

47. Comparisons
Formulate particular questions/hypothesis for subgroups of comparisons,
- Slit and Robo, Robo2 mutants have similar
phenotypes, compare their gene expression
- Compare Robo1, Robo2, and Robo1,2
- etc.

48. Data Analysis Using Affy R-package (Bolstad, Irizarry)
Quantile normalization (Bolstad 2001)
Currently implementing an additiv model on the probe pair level:
- simultanously for mutant/WT
- incorporates replicates

49. Acknowledgement Ben Bolstad Sandrine Dudoit Phil Spector Terry Speed
Jean Yee Hwa Yang
(UCB Statistics)
Tiago Magelhaes (Goodman lab, UCB)
Paolo Marciano (Pennsylvania)
Francois Collin
(Genlogic)
Rafael Irizarry
(Johns Hopkins)