1. What are Microsatellites?
D2S123
TAGGCCACACACACACACACA
Unique
Primer
• Mono, di, tri, tetra nucleotide repeats
• HNPCC - Expansion/contraction of nl repeats

3. Strand Slippage D2S123 14 bp 12 bp TAGGCCACACACACACACACA
Unique
Primer
13-15 BP
4-40 RPTS
12 bp
TAGGCCACACACACACACACA

4. Mis-Match Repair Genes
• hMSH2
• hMLH1
• PMS1
• PMS2
• hMSH3
• hMSH6

5. Click for larger picture

6. Click for larger picture

7. Risk of CRC in Clinical HNPCC Families: Netherlands
Sporadic
Age
Location pr: 53% pr: 32%
ds: 41% ds: 68%
CI % %
CI % %
CI % %
Voskuil, Int J CA 1997;72:205

8. Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands%
CRC Lifetime 80
Women 83
Men
Endometrial 50
Vasen, Gastro 1996;110:1020

9. HNPCC • ~ 90% of tumors show MI • Germline defect in MMR genes
• 2nd Hit - Somatic Mutation

10. MSI in Sporadic CRC • In HNPCC: Germline + somatic = MSI
• % of sporadic CRC
• In HNPCC: Germline + somatic = MSI
• Sporadic - biallelic somatic mutation via methylation of MLH1 promoter

11. Click for larger picture
TC = Transcription Complex
Click for larger picture

12. Gene Testing for hMLH1 or hMSH2
• DGGE
• SSCP
• IVSP
• Direct Sequencing

13. Gene Testing Cost ($) Sensitivity Sequencing >90% 800 - 3,000
CSGE & Sequencing >90%
Screening (SSCP) %
Screening (PTT) %
MSI NA
Gastro 2001;121:195

14. Gene Testing for MSH2/MLH1
509 Finnish CRC pts
5/10 Founder mutation
7/10 Amsterdam Criteria
All either young, had fam hx, or previous CA
63 MSI
10 (2%) MMR mutations
Aaltonen, NEJM 1998;38:1481

15. Predictive Model for MMR Gene Testing
184 Kindreds: 26% w/ MMR mutations
1) Mean age at diagnosis of affecteds
2) At least 1 member w/ Endometrial CA
3) Amsterdam Criteria
Wijnen, NEJM 1998;339:511

16. Predictive Model for MMR Gene Testing
Logistic Model
Prob <20%
Prob >20%
MMR
Analysis
MSI - +
MMR
Analysis
Nothing
Wijnen, NEJM 1998;339:511

19. Bethesda Criteria and MMR Mutation
N=125, “high risk”, Frankfurt, GE
+ BC
- BC
Total
N 58 (46%) 67 (54%)
MSI 17 (29%) 5 (7.5%) (18%)
MMR Mutation 11 (65%) 0 (0%) (9%)
B1 - B4 46 (79%)
Raedle, Ann Int Med 2001;135:566

20. MMR Mutation MSI status Criteria to predict MSI
Bethesda vs. Amsterdam
MMR Mutation MSI status
Criteria to predict MSI
Sens
Spec
Amsterdam 6/
Amsterdam II 8/
Bethesda /
Raedle, Ann Int Med 2001;135:566

21. Cost Effectiveness of MSI
• Decision tree using MSI (Bethesda guidelines) and MMR mutations
• 90% CI for cost-effectiveness of screening patients with cancer & relatives:
$4, ,576 / life year gained
• Sensitivity analysis - prevalence HNPCC mutation #1 factor
Ramsey, Ann Int Med 2001;135:577

22. Click for larger picture

23. Mutations in HNPCC Kindreds
• 32 Kindreds (N=38) in Buffalo and Vermont
• Amsterdam Criteria
Incidence of Mutations MSH2/MLH1:
25%
Conclusion:
• Molecular basis unknown for
many subjects
Weber, Cancer Res 1997;57:3798

24. Effectiveness of Screening in HNPCC
• 252 subjects, 22 Families (119 Control, 133 screen)
• Colon q3yrs, 1984, 15 yr F/U
• Not randomized - declined participation
Screen
Control OR P
CRC 8 (6%) (16%)
Mutation % 41%
Deaths to CRC % <.001
Jarvinen, Gastro 2000;118

25. Click for larger picture

26. Risk of Metachronous CRC

27. Colonoscopy in High Risk Individuals
31 HNPCC Families Individuals
86 (38.6%) underwent colonos-compared to controls
Case Control P CA
Adenomas
TV/V (#)
Ad Diam
HGD (#)
Ponz de Leon, CEBP 1998;7:639

28. Center for Families at Risk for CRC
Jan ‘98 - June ‘00
Goal: To develop a registry of high risk families
To assemble blood/DNA for research
Recruitment: Physician referral, Media, UPCI CA Registry
High Risk Definition: Young onset, FDR young onset,
Multiple cancers
Overall: 83 individuals (76 families)

29. UPCI Registry 188 Alive Dead 82 106 Agreed 26 23 33 Unavailable Not
Interested
11 (5.9%)
Young onset cancers - <45, 45-55
Enrolled

30. High Risk Patients 70 Probands - Complete data, exclude FAP
23 Young Onset (<55)
9 Multiple CA’s
15 Young and Multiple (8 Amsterdam Criteria)

31. Problems With Center • Lab Support • Integrated Recruitment
• Coordinated Approach With Other Cancers

32. Gene Testing • •