Presentation is loading. Please wait.

Presentation is loading. Please wait.

What are Microsatellites?

Similar presentations


Presentation on theme: "What are Microsatellites?"— Presentation transcript:

1 What are Microsatellites?
D2S123 TAGGCCACACACACACACACA Unique Primer • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats

2

3 Strand Slippage D2S123 14 bp 12 bp TAGGCCACACACACACACACA
Unique Primer 13-15 BP 4-40 RPTS 12 bp TAGGCCACACACACACACACA

4 Mis-Match Repair Genes
• hMSH2 • hMLH1 • PMS1 • PMS2 • hMSH3 • hMSH6

5 Click for larger picture

6 Click for larger picture

7 Risk of CRC in Clinical HNPCC Families: Netherlands
Sporadic Age Location pr: 53% pr: 32% ds: 41% ds: 68% CI % % CI % % CI % % Voskuil, Int J CA 1997;72:205

8 Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands
% CRC Lifetime 80 Women 83 Men Endometrial 50 Vasen, Gastro 1996;110:1020

9 HNPCC • ~ 90% of tumors show MI • Germline defect in MMR genes
• 2nd Hit - Somatic Mutation

10 MSI in Sporadic CRC • In HNPCC: Germline + somatic = MSI
• % of sporadic CRC • In HNPCC: Germline + somatic = MSI • Sporadic - biallelic somatic mutation via methylation of MLH1 promoter

11 Click for larger picture
TC = Transcription Complex Click for larger picture

12 Gene Testing for hMLH1 or hMSH2
• DGGE • SSCP • IVSP • Direct Sequencing

13 Gene Testing Cost ($) Sensitivity Sequencing >90% 800 - 3,000
CSGE & Sequencing >90% Screening (SSCP) % Screening (PTT) % MSI NA Gastro 2001;121:195

14 Gene Testing for MSH2/MLH1
509 Finnish CRC pts 5/10 Founder mutation 7/10 Amsterdam Criteria All either young, had fam hx, or previous CA 63 MSI 10 (2%) MMR mutations Aaltonen, NEJM 1998;38:1481

15 Predictive Model for MMR Gene Testing
184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria Wijnen, NEJM 1998;339:511

16 Predictive Model for MMR Gene Testing
Logistic Model Prob <20% Prob >20% MMR Analysis MSI - + MMR Analysis Nothing Wijnen, NEJM 1998;339:511

17

18

19 Bethesda Criteria and MMR Mutation
N=125, “high risk”, Frankfurt, GE + BC - BC Total N 58 (46%) 67 (54%) MSI 17 (29%) 5 (7.5%) (18%) MMR Mutation 11 (65%) 0 (0%) (9%) B1 - B4 46 (79%) Raedle, Ann Int Med 2001;135:566

20 MMR Mutation MSI status Criteria to predict MSI
Bethesda vs. Amsterdam MMR Mutation MSI status Criteria to predict MSI Sens Spec Amsterdam 6/ Amsterdam II 8/ Bethesda / Raedle, Ann Int Med 2001;135:566

21 Cost Effectiveness of MSI
• Decision tree using MSI (Bethesda guidelines) and MMR mutations • 90% CI for cost-effectiveness of screening patients with cancer & relatives: $4, ,576 / life year gained • Sensitivity analysis - prevalence HNPCC mutation #1 factor Ramsey, Ann Int Med 2001;135:577

22 Click for larger picture

23 Mutations in HNPCC Kindreds
• 32 Kindreds (N=38) in Buffalo and Vermont • Amsterdam Criteria Incidence of Mutations MSH2/MLH1: 25% Conclusion: • Molecular basis unknown for many subjects Weber, Cancer Res 1997;57:3798

24 Effectiveness of Screening in HNPCC
• 252 subjects, 22 Families (119 Control, 133 screen) • Colon q3yrs, 1984, 15 yr F/U • Not randomized - declined participation Screen Control OR P CRC 8 (6%) (16%) Mutation % 41% Deaths to CRC % <.001 Jarvinen, Gastro 2000;118

25 Click for larger picture

26 Risk of Metachronous CRC

27 Colonoscopy in High Risk Individuals
31 HNPCC Families Individuals 86 (38.6%) underwent colonos-compared to controls Case Control P CA Adenomas TV/V (#) Ad Diam HGD (#) Ponz de Leon, CEBP 1998;7:639

28 Center for Families at Risk for CRC
Jan ‘98 - June ‘00 Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers Overall: 83 individuals (76 families)

29 UPCI Registry 188 Alive Dead 82 106 Agreed 26 23 33 Unavailable Not
Interested 11 (5.9%) Young onset cancers - <45, 45-55 Enrolled

30 High Risk Patients 70 Probands - Complete data, exclude FAP
23 Young Onset (<55) 9 Multiple CA’s 15 Young and Multiple (8 Amsterdam Criteria)

31 Problems With Center • Lab Support • Integrated Recruitment
• Coordinated Approach With Other Cancers

32 Gene Testing


Download ppt "What are Microsatellites?"

Similar presentations


Ads by Google