Presentation is loading. Please wait.

Presentation is loading. Please wait.

Supplementary Table 1. Primers used for sequence analysis and detection of a novel ilarvirus (apple necrotic mosaic virus, ApNMV) and Apple mosaic virus.

Published byDina Todd Modified over 6 years ago

Similar presentations

Presentation on theme: "Supplementary Table 1. Primers used for sequence analysis and detection of a novel ilarvirus (apple necrotic mosaic virus, ApNMV) and Apple mosaic virus."— Presentation transcript:

1 Supplementary Table 1. Primers used for sequence analysis and detection of a novel ilarvirus (apple necrotic mosaic virus, ApNMV) and Apple mosaic virus (ApMV) Use Primer Sequence　(5´-3´) Sequence analysis R1-node268+ atgcttccgagattcaggag R1-node31- cttcgaagtagttagcgtcc R1-node31+ agacacacgaagaggttcac R2-node305+ ggaagacggatgtgtcgaaa R3-node76+ ttccatcttgcgtgcaatcg 5’RACE-R1-S1 agttgaacgctcattaccga 5’RACE-R1-S2 ggaaggtgagagactaaatg 5’RACE-R1-A1 acgtctcgtctgcacattgt 5’RACE-R1-A2 gtggatactagcaactcgga 5’RACE-R1-RT acagagccttctgct 5’RACE-R2-S1 cgtggattgtggacagatgg 5’RACE-R2-S2 ggtgtttgacattccgacac 5’RACE-R2-A1 ctcgaacttcggtctgaaga 5’RACE-R2-A2 tctcacatctcccatacgac 5’RACE-R2-RT tgactgactgttgag 5’RACE-R3-S1 gtcgaaacagatgacttacg 5’RACE-R3-S2 ccgaatcccatcatgtttcc 5’RACE-R3-A1 acacatgtctccaactcgag 5’RACE-R3-A2 caccaactttgctttcgacg 5’RACE-R3-RT tgtgctggacacgtt Detection of ApNMV and ApMV ApNMV-CP+1 cttgcgtgcaatcgatatgg ApNMV-CP-1 tcatctcaacctagacatcc ApMV-CP+1 caacatggtctgcaagtact ApMV-CP-1 ggagctaatcgctccatcat ApNMV-CP+2 atggtgtgcaatcgctgtca ApNMV-CP-2 catcgaccataaggatatca ApMV-CP+2 tggatcttgcgctggatgca ApMV-CP-2 acattcgtcggtatttgcac

2 Supplementary Table 2. Number of contigs from next generation sequencing of an apple tree (P129) matched to viral sequences by blastx analysis No. of contigs Matched virus (genus) Identity (%) 280 Apple stem pitting virus (Foveavirus) 100~61.33 18 Apricot latent virus-like (Foveavirus) 98.36~88.37 65 Apple stem grooving virus (Capillovirus) 100~74.89 5 Apple chlorotic leaf spot virus (Trichovirus) 100~93.15 11 Prunus necrotic ringspot virus (Ilarvirus) 76.19~65.28 1 Apple mosaic virus (Ilarvirus) 57.34 105 Other Total 485

3 Supplementary Table 3. Percentage of nucleotide and amino acid sequence identities of CPs among viruses (P129, PK45, PK28, and P133) from apple trees showing mosaic symptoms and ApMV Tree P129 PK45 PK28 P133 ApMV P129 (219 aa) 94 56 PK45 (219 aa) 95 PK28 (219 aa) 92 55 P133 (223 aa) 43 44 88 ApMV (219 aa) 91 The upper right corner represents nucleotide sequence identities, and the lower left corner is amino acid sequence identities. The sequence of apple mosaic virus (ApMV) was from GenBank/EMBL/.DDBJ database accession no. U15608.

Download ppt "Supplementary Table 1. Primers used for sequence analysis and detection of a novel ilarvirus (apple necrotic mosaic virus, ApNMV) and Apple mosaic virus."

Similar presentations

Table 1. Degenerate potyvirus primers used to detect potyviruses in Iraqi plants by RT-PCR. NT: not tested, NS: non specific bands, +: positive, -: negative,

Table 1. Degenerate potyvirus primers used to detect potyviruses in Iraqi plants by RT-PCR. NT: not tested, NS: non specific bands, +: positive, -: negative,
Insert 2000 0 1 1 0 0 1 0 0 0 A tree starts with the dummy node D 0 0 0 0 0 0 0 0 0 0 D 200 D 7 Insert 1000 0 0 1 1 0 0 1 0 0 100 D 6 200 7.

Insert A tree starts with the dummy node D D 200 D 7 Insert D
ResistVir Mechanisms and sources of resistance Josef SPAK Academy of Sciences of the Czech Republic, Ceske Budejovice

ResistVir Mechanisms and sources of resistance Josef SPAK Academy of Sciences of the Czech Republic, Ceske Budejovice
PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.
Agricultural Research Institute of the Hungarian Academy of Sciences Detecting inter- and intraspecific recombination events in plant RNA viruses with.

Agricultural Research Institute of the Hungarian Academy of Sciences Detecting inter- and intraspecific recombination events in plant RNA viruses with.
Stem and Leaf Bingo. Pick 8 from the list 037329 3039391 15132419 343525 18271638 3132332.

Stem and Leaf Bingo. Pick 8 from the list
Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium.

Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium.
Point Mutations Silent Missense Nonsense Frameshift.

Point Mutations Silent Missense Nonsense Frameshift.
Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.

Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.
Copyright OpenHelix. No use or reproduction without express written consent1.

Copyright OpenHelix. No use or reproduction without express written consent1.
Question 4 Tutorial 8. Part A Insert 20, 10, 15, 5,7, 30, 25, 18, 37, 12 and 40 in sequence into an empty binary tree. 20 15 12 18 25 10 37 5 7 30 40.

Question 4 Tutorial 8. Part A Insert 20, 10, 15, 5,7, 30, 25, 18, 37, 12 and 40 in sequence into an empty binary tree
Primers to map bsd deletion points on genomic DNA NameForwardReverse Amplicon size (base pairs) A15’-CCACGGATGGAGTGAGTTCT-3’5’-GCCCCCAAGATGAGGATTAT-3’931.

Primers to map bsd deletion points on genomic DNA NameForwardReverse Amplicon size (base pairs) A15’-CCACGGATGGAGTGAGTTCT-3’5’-GCCCCCAAGATGAGGATTAT-3’931.
DNA Questions What makes up a DNA backbone? How would you describe how DNA looks? Name the 4 bases that make up DNA. “T” base can only match with? What.

DNA Questions What makes up a DNA backbone? How would you describe how DNA looks? Name the 4 bases that make up DNA. “T” base can only match with? What.
BrGGP2 Gene information BrGGP Gene information

BrGGP2 Gene information BrGGP Gene information
Table S4. Properties of H5N1 influenza viruses in sublineage BI.

Table S4. Properties of H5N1 influenza viruses in sublineage BI.
Variation among organisms

Variation among organisms
Supplemental Digital Content 1. Table: Primers

Supplemental Digital Content 1. Table: Primers
S1 File. Numbers of reads mapped on reference viral sequences – SOAP.

S1 File. Numbers of reads mapped on reference viral sequences – SOAP.
Reads aligned into contigs

Reads aligned into contigs
Supplementary Figure 1 ORF2 ORF3 Nelorpivirus (Group I Negevirus)

Supplementary Figure 1 ORF2 ORF3 Nelorpivirus (Group I Negevirus)

Similar presentations

Ads by Google