1. Gene expression…
- Pooja Gupta

2. Gene is expressed by transcribing DNA into single-stranded mRNA
mRNA is later translated into a protein
Cells are different because of differential gene expression
About 40% of human genes are expressed at one time
mRNA expression represents dynamic aspects of cell

3. Gene expression DNA mRNA Protein PEPTIDE transcription translation
CCTGAGCCAACTATTGATGAA
CCUGAGCCAACUAUUGAUGAA
PEPTIDE

4. mRNA Stability
The amount of translatable mRNA is a
product of both synthesis and decay:
Synthesis Decay
DNA → mRNA→ Nucleotides

5. Synthesis Decay
→[mRNA] →
When d(mRNA)/dt = 0;
Rate of synthesis = Rate of decay
∴mRNA at “Steady State”

6. Regulation of [mRNA]
Any change from one steady-state to another may be due to a change in the rate of synthesis or the rate of decay, or both.
Therefore, when mRNA levels increase, we are unable to conclude that the increase was due to increased transcription.
However, this change in [mRNA] usually leads to a change in translation (change in functional capability of cell).

7. Detection and quantification of RNA
transcripts
Various methods for detection and quantification of mRNA are available, however they are differ by:
Accuracy
Sensitivity
Throughput

8. Overview Gene expression Northern Blots RPA RT-PCR SAGE MicroArray
mRNA
protein
Northern Blots
RPA
RT-PCR
SAGE
MicroArray

9. Ultimate goal is to develop the ability to scan the mRNA
expression state of all the genes for a particular genome
simultaneously

10. Northern Blots Cellular RNA separated by gel electrophoresis
Separated mRNA pattern transferred to nylon membrane
Hybridized with radioactive probe (made from cDNA clone)
Slot Blot
Northern Blot

11. RNase Protection Assay
More sensitive, more precise than Northern
Synthetic, radioactive RNA transcribed
from cDNA clone
Probe hybridized with mRNA in solution
RNase destroys unpaired probe
“Protected” probe separated by hi-res gel electrophoresis

13. RPA (continue) Presence of protected band indicates presence of mRNA
Intensity indicates steady-state [mRNA]
Combine several probes to several mRNAs
Identify by characteristic size
Very sensitive, very specific!

14. RT-PCR Measures relative expression of mRNA 1. Isolate and purify mRNA
2. reverse transcription
3. PCR amplification
4. run on gel and probe/hybridize
First, the mRNA’s are isolated and purified.
Next, the mRNA is reverse transcribed, possibly using a gene-specific primer. Recall that transcription normally makes an RNA copy from a DNA template. This is reverse transcription, as it is making a DNA copy from an RNA template.
Next, standard PCR is used to amplify the number of copies of the transcript under study.
Finally, the resulting product is run out on a gel and probed.

15. RT-PCR

16. RT-PCR Why use RT? The bad… Can observe very low levels of expression
Requires very small amounts of mRNA
The bad…
Potential expression-level skew due to non-linearity of PCR
Have to design multiple custom primers for each gene.
First, the mRNA’s are isolated and purified.
Next, the mRNA is reverse transcribed, possibly using a gene-specific primer. Recall that transcription normally makes an RNA copy from a DNA template. This is reverse transcription, as it is making a DNA copy from an RNA template.
Next, standard PCR is used to amplify the number of copies of the transcript under study.
Finally, the resulting product is run out on a gel and probed.

17. SAGE Often called the poor man’s micorarray.
Utilizes sequencing capacity to assess mRNA expression levels.
Similar to EST sequencing, the difference being that only a portion of each mRNA is sequend. This is accomplished using a family of restirction enzymes that cleave the DNA at a specific distance from their recognition site. A second restriction site is the used to isolate the “tag” region (by size selection). The tag regions are then ligated to form di-tags - two tags joined together at the restrcition #2 site (which forms a “sticky” site, the first RE forms a blunt site).
The di-tags are then concatemerized by adding an adaptor to both ends of the di-tag containing a rare-cutting enzyme.
The resulting di-tag multimers are then sequenced.
Assuming 11 base di-tags and an 8 base adapter, each di-tag is 30 bp long. This each concatenated sequence yields approx. 10 di-tags --> 10 mRNA tags. (assuming only 300 bp of good sequence) --> 2000 per 96 lane sequencing gel.
Analysis: remove di-tags in excess of expected frequency, as these are typically contaminated.

18. SAGE Often called the poor man’s micorarray.
Utilizes sequencing capacity to assess mRNA expression levels.
Similar to EST sequencing, the difference being that only a portion of each mRNA is sequend. This is accomplished using a family of restirction enzymes that cleave the DNA at a specific distance from their recognition site. A second restriction site is the used to isolate the “tag” region (by size selection). The tag regions are then ligated to form di-tags - two tags joined together at the restrcition #2 site (which forms a “sticky” site, the first RE forms a blunt site).
The di-tags are then concatemerized by adding an adaptor to both ends of the di-tag containing a rare-cutting enzyme.
The resulting di-tag multimers are then sequenced.
Assuming 11 base di-tags and an 8 base adapter, each di-tag is 30 bp long. This each concatenated sequence yields approx. 10 di-tags --> 10 mRNA tags. (assuming only 300 bp of good sequence) --> 2000 per 96 lane sequencing gel.
Analysis: remove di-tags in excess of expected frequency, as these are typically contaminated.

19. SAGE Tags are isolated and concatermized.
Relative expression levels can be compared between cells in different states.

20. SAGE --gene to tag mapping

21. Microarray
- A Glass slide or silicon chip onto which spots of many different DNA probes have been deposited. Used for simultaneous measurement of gene expression levels of many genes in the same tissue sample.

22. What we hope to learn Microarrays
Understand the principles of the microarray technique.
Appreciate the limitations of microarrays and problems associated with the technique.
Know what types of output are generated from different microarray analysis packages and what they mean.
Understand and be able to evaluate research papers about microarrays.

23. Why Learn about Microarrays ?
Extremely useful and powerful technology – given a sample of human tissue, allows you to determine the expression level of all human genes within that tissue.
Now extremely widely used, not only in research laboratories but also within commercial companies and diagnostically in hospitals.
Many research articles written involving microarray data – bioinformatics is vital for understanding these data and results.

24. Microarrays are Popular
The NYU Med Center collects about 3 GB of microarray data per week
NCBI GEO 80K curate sample sets
PubMed search "microarray"= 13,948 papers
2005 = 4406
2004 = 3509
2003 = 2421
2002 = 1557
2001 = 834
2000 = 294

25. What is a Microarray ? Sample
Mark Schena, one of the founders of the technology in early 1990s at Stanford, says microarrays need to be:
Microscopic ordered arrays of specific probes on a planar surface.
3. Scan
Sample
1. Label sample
2. Wash Over Array

26. For Example - Protein Microarrays
Different Proteins
Different Antibodies
3. Scan
Sample
1. Label sample
2. Wash Over Array

27. Our Focus – Gene Expression Microarrays
Complementary DNA sequences
Different mRNAs
3. Scan
Sample
1. Label sample
2. Wash Over Array

28. Gene Expression Microarrays – Key Concepts
3. Sequence specific nucleic acid hybridization A T C
Tissue biopsy or cell culture
1. mRNA extraction U A G A C U U A G T A G
2. Reverse transcription to cDNA and labelling A T C G T A G

29. Goals of a Microarray Experiment
Find the genes that change expression between experimental and control samples
Classify samples based on a gene expression profile
Find patterns: Groups of biologically related genes that change expression together across samples/treatments

30. Two Major Gene Expression Microarray Technologies
Spotted Arrays
Affymetrix GeneChips
We will examine their manufacture and their use.

31. Spotted Microarrays – Manufacture
Pat Brown has plans $30K
DNA probes spotted onto the microarray can either be cDNA created by PCR or synthetic oligonucleotides.
The probes are physically spotted onto particular positions on a glass slide using a robot and immobilized using specific surface chemistry.

32. Spotted Microarrays – Manufacture
Spotted microarrays can
also be manufactured
‘by hand’.

33. Spotted Microarrays – Example Use
As an example, we will look at detecting differences between acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML) . This was one of the first successful uses of microarrays in cancer classification.
Total mRNA was extracted from bone marrow taken from patients with ALL and AML.
Converted to cDNA by reverse transcription (since mRNA is sensitive to degradation).
T.R. Golub et. al (1999) Molecular Classification of Cancer: Class Discovery and Class Prediction by Gene Expression Monitoring. Science, vol. 286,

34. Spotted Microarrays – Two Channels
ALL cDNAs
AML cDNAs
Spot Interpretation
Green Spot – higher expression in ALL.
Red Spot – higher expression in AML.
Yellow Spot – equal expression in both.
Black Spot – not expressed in either.
Cy3 Dye Label
Cy5 Dye Label
Mix and hybridize onto slide

35. Affymetrix GeneChip – Manufacture
Oligonucleotides are synthesized one nucleotide at a time on the surface of a quartz wafer using photolithographic chemistry in clean room conditions.

36. Affymetrix “Gene chip” system
Uses 25 base oligos synthesized in place on a chip (20 pairs of oligos for each gene) 20,000 genes/chip
RNA labeled and scanned in a single “color
Arrays get smaller every year (more genes)
Chips are expensive
Proprietary system: “black box” software, can only use their chips

37. Affymetrix GeneChip – Single Channel
ALL cDNAs
Biotin Label
Hybridize
Scan
AML cDNAs