Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA: The Genetic Material

Similar presentations


Presentation on theme: "DNA: The Genetic Material"— Presentation transcript:

1 DNA: The Genetic Material

2 Identifying the Genetic Material
Experiments of Griffith and Avery yielded results that suggested DNA was genetic material (1944)

3 Hershey & Chase used the bacteriophage T2 and radioactive labels to show that virus genes are made of DNA, not protein (1952)

4 DNA stores information that tells cells which proteins to make and when to make them

5 The Structure of DNA Discovered by Watson & Crick in 1953 & received Nobel Prize in 1962 along with Maurice Wilkins

6 DNA  Polymer : Nucleotide  Monomer
Each Nucleotide has 3 parts: 1) 5 carbon sugar  Deoxyribose 2) Phosphate group  PO4 3) Nitrogen Base

7

8

9

10 DNA forms a spiral ladder  Double Helix
T G C Human 30 19 Plant 27 22 Virus 21 28 DNA forms a spiral ladder  Double Helix Double helix is held together by weak Hydrogen bonds Erwin Chargaff Discovery Chargaff’s Rule A=T, G=C Dfgsdg

11 DNA Replication Phase of Cell Cycle? Why replicate?
Step 1: DNA Helicase unzips DNA by breaking weak Hydrogen bonds. Step 2: DNA polymerase adds nucleotides to exposed nitrogen bases. Step 3: Two DNA molecules form that are identical to original.

12 DNA is referred to as “Semi-conservative”, Each DNA molecule  1 template & 1 new strand
DNA polymerase proofreads DNA during its replication so that very few errors occur

13 500/sec bacteria 50/sec human

14

15 Figure 8.2 DNA and RNA. (a) DNA is double stranded. Each DNA nucleotide is composed of the sugar deoxyribose, a phosphate group and a nitrogen containing base (A, G, C, or T). (b) RNA is single stranded. RNA nucleotides are composed of the sugar ribose, a phosphate group and a nitrogen containing base (A, G, C, or U). Note the difference in the sugars is shown in the pink boxes.

16 Gene 2 Gene 1 Gene 3 DNA template strand mRNA Codon TRANSLATION
Fig. 17-4 Gene 2 DNA molecule Gene 1 Gene 3 DNA template strand TRANSCRIPTION Figure 17.4 The triplet code mRNA Codon TRANSLATION Protein Amino acid

17 Fig. 17-3a-2 In prokaryotes, mRNA produced by transcription is immediately translated without more processing DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information (a) Bacterial cell

18 Nuclear envelope DNA TRANSCRIPTION Pre-mRNA mRNA TRANSLATION Ribosome
Fig. 17-3b-3 Nuclear envelope DNA TRANSCRIPTION Pre-mRNA RNA PROCESSING mRNA Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information TRANSLATION Ribosome Polypeptide (b) Eukaryotic cell

19 Transcription Occurs in the nucleus
Occurs in the nucleus An RNA polymerase enzyme binds to the promoter and makes a mRNA (messenger RNA) complementary to the DNA gene

20 Translation Occurs in the cytoplasm mRNA carries the code from the DNA
Amino acids are assembled to synthesize proteins at ribosomes

21 Translation tRNA (transfer RNA) carries amino acids, which bind to three-letter nucleotide sequences on the mRNA (codons)

22 Figure 8.7 Translation. During translation, mRNA directs the synthesis of a protein. The mRNA codon that is exposed in the ribosome binds to its complementary tRNA molecule, which carries the amino acid coded for by the DNA gene. When many amino acids are joined together, the required protein is produced. When the translation machinery reaches a stop codon, the newly synthesized protein is released into the cytoplasm.

23 Figure 8.7 Translation. During translation, mRNA directs the synthesis of a protein. The mRNA codon that is exposed in the ribosome binds to its complementary tRNA molecule, which carries the amino acid coded for by the DNA gene. When many amino acids are joined together, the required protein is produced. When the translation machinery reaches a stop codon, the newly synthesized protein is released into the cytoplasm.

24 mRNA: AUG CCG AUC AUG UAA

25 Fig DNA TRANSCRIPTION 3 Poly-A RNA polymerase 5 RNA transcript RNA PROCESSING Exon RNA transcript (pre-mRNA) Intron Aminoacyl-tRNA synthetase Poly-A NUCLEUS Amino acid AMINO ACID ACTIVATION CYTOPLASM tRNA mRNA Growing polypeptide Cap 3 A Activated amino acid Poly-A P Ribosomal subunits Figure A summary of transcription and translation in a eukaryotic cell E Cap 5 TRANSLATION E A Anticodon Codon Ribosome

26 Mutation Mutation – a change in the DNA
Mutation – a change in the DNA

27 mutations The cat ate the mouse Tec ata tet hem ouse (deletion)
Thh eca tat eth emous (addition) The rat ate the mouse (substitution)

28 Effects of change made in the protein can vary
Neutral mutation - No effect occurs when the mutation in the DNA does not change the amino acid that is called for If one base is added (insertion) or deleted (deletion), you get a frameshift mutation Most devastating

29 Sickle cell Cystic fibrosis Cancer
Sickle cell Cystic fibrosis Cancer

30 GATCTCTTAGGGTCTTACGCT
CUAGAGAAUCCCAGAAUGCGA LEUCINE, GLUTAMIC ACID, ASPARAGINE, PROLINE, ARGININE, METHIONINE, ARGININE CUAGAGAAUACCAGAAUGCGA LEUCINE, GLUTAMIC ACID, ASPARAGINE, THREONINE, ARGININE, METHIONINE, ARGININE

31


Download ppt "DNA: The Genetic Material"

Similar presentations


Ads by Google