1. RNA molecule
RNA fragment
Activity Intro Slide:
When performing an RNA-seq experiment, we can make several changes to the sequencing protocol that can have drastic effects on our ability to align and analyze the resulting data. These include increasing the length of the RNA-seq reads, performing paired-end sequencing, or using fragment length information. Here, we’re going to explore each of these options and see how they affect our sequencing results.
When performing an RNA-seq experiment, we need to prepare RNA molecules for sequencing. These include breaking large RNA molecules into smaller pieces (fragments),

2. RNA molecule
RNA fragment
Activity Intro Slide:
When performing an RNA-seq experiment, we can make several changes to the sequencing protocol that can have drastic effects on our ability to align and analyze the resulting data. These include increasing the length of the RNA-seq reads, performing paired-end sequencing, or using fragment length information. Here, we’re going to explore each of these options and see how they affect our sequencing results.
fragment ready for sequencing
When performing an RNA-seq experiment, we need to prepare RNA molecules for sequencing. These include breaking large RNA molecules into smaller pieces (fragments), and making other changes to the molecule so it is recognized by the sequencing machine.

3. RNA molecule
RNA fragment
Activity Intro Slide:
When performing an RNA-seq experiment, we can make several changes to the sequencing protocol that can have drastic effects on our ability to align and analyze the resulting data. These include increasing the length of the RNA-seq reads, performing paired-end sequencing, or using fragment length information. Here, we’re going to explore each of these options and see how they affect our sequencing results.
fragment ready for sequencing
Sequencing read (30 bp)
cccaaccttcccacagctcacagcatcccc
When performing an RNA-seq experiment, we need to prepare RNA molecules for sequencing. These include breaking large RNA molecules into smaller pieces (fragments), and making other changes to the fragments so they are recognized by the sequencing machine. Finally, we load the fragments into the sequencer which reads a specific number of letters (or base pairs) from one end of the fragment.

4. Paired-end sequencing
RNA molecule
RNA fragment
Activity Intro Slide:
When performing an RNA-seq experiment, we can make several changes to the sequencing protocol that can have drastic effects on our ability to align and analyze the resulting data. These include increasing the length of the RNA-seq reads, performing paired-end sequencing, or using fragment length information. Here, we’re going to explore each of these options and see how they affect our sequencing results.
fragment ready for sequencing
Sequencing read (30 bp)
cccaaccttcccacagctcacagcatcccc
Possible modifications:
Increase read length
Paired-end sequencing
Fragment length info
However, we can make several changes to the way we perform the sequencing. These changes can have a huge effect on our ability to align and analyze the resulting data. These include increasing the length of the RNA-seq reads, performing paired-end sequencing, or using fragment length information. Here, we’re going to explore each of these options and see how they affect our sequencing results.

5. RNA molecule
RNA fragment
Increase read length:
When performing an RNA-seq experiment, we sequence a specific number of nucleotides from one end of an RNA fragment. We can chose to sequence more nucleotides, which reveals more of the RNA fragment’s sequence. Here we increased the read length from 30 bp to 75 bp.
fragment ready for sequencing
Sequencing read (30 bp)
cccaaccttcccacagctcacagcatcccc OR
Sequencing read (75 bp)
cccaaccttcccacagctcacagcatccccccacagcatggacagcatgctgccctctggagaaggtggcccaaa
Increase read length:
When performing an RNA-seq experiment, we sequence a specific number of nucleotides from one end of an RNA fragment. We can chose to sequence more nucleotides, which reveals more of the RNA fragment’s sequence. Here we increased the read length from 30 bp to 75 bp.

6. Paired-end sequencing:
RNA molecule
RNA fragment
Paired-end sequencing:
In RNA-seq experiments, we generate sequencing reads from the ends of RNA fragments. We have the option of sequencing one, or both ends of an RNA fragment. Since we generate a pair of reads when we sequence both ends of a fragment, we call this method paired-end sequencing.
fragment ready for sequencing
Sequencing reads (paired )
cccaaccttcccacagctcacagcatcccc
acaggataagagggtcatcgccttctagct
Read
Paired read
Paired-end sequencing:
In RNA-seq experiments, we generate sequencing reads from the ends of RNA fragments. We have the option of sequencing one, or both ends of an RNA fragment. Since we generate a pair of reads when we sequence both ends of a fragment, we call this method paired-end sequencing.

7. Use fragment length information:
RNA molecule
RNA fragment
Use fragment length information:
When preparing RNA fragments for sequencing, we can measure the average lengths of all the fragments in our sample. If we use this information when performing paired-end sequencing, we can calculate the distance we expect to see between read pairs.
fragment ready for sequencing bp
Measure fragment length
50 bp
50 bp
Sequencing reads (paired )
Calculate distance between reads bp
Use fragment length information:
When preparing RNA fragments for sequencing, we can measure the average lengths of all the fragments in our sample. If we use this information when performing paired-end sequencing, we can calculate the distance we expect to see between read pairs.