Presentation is loading. Please wait.

Presentation is loading. Please wait.

ELIXIR UK TeSS Training Portal

Similar presentations


Presentation on theme: "ELIXIR UK TeSS Training Portal"— Presentation transcript:

1 ELIXIR UK TeSS Training Portal
TeSS (Training eSupport System) is a portal for disseminating, discovering and packaging training resources, aggregating information from ELIXIR Nodes and 3rd-party providers. The platform acts as a ‘department store’, where its ‘departments’ (ELIXIR Nodes) promote their latest news and events, and contribute to its catalogue of training materials. The catalogue may be navigated via ‘training workflows’ or relevant materials collected into bespoke training ‘packages’. Aggregate Link Combine TeSS aggregates training resources from ELIXIR nodes and 3rd-party providers Aggregation is done automatically by harvesting materials from providers’ sites, with no or minimal manual intervention Collected training materials can be combined into various training packages and training workflows TeSS is not a repository – it does not store the actual training materials TeSS stores links to content providers’ training materials with appropriate attribution Other registries TeSS Link Link Link  CTCTCACTGAATCAGTACCAAATGCACTCACAT MNATDAVLGAAILAGTACVSNATHWQFAAVL Link Content Providers Aggregate Combine Combine Training Materials Training Packages Training Workflows Training resources, news and events specific for ELIXIR Nodes TeSS aims to provide an at-a-glance view of the ELIXIR training landscape, while also offering individual ’shop windows’, giving customisable views of the hottest training news, events, activity highlights, etc. from ELXIR nodes, as well as a more general view of training materials from selected non-ELIXIR providers. Linking Up With Other ELIXIR Nodes Training materials can be linked to relevant services, datasets and tools from ELIXIR Denmark’s Tools and Data Services Registry, Web services from ELIXIR UK’s BioCatalogue and data policies and standards from ELIXIR UK’s BioSharing. Lead organisations Collaborators University of Manchester Terri Atwood, Carole Goble Niall Beard, Aleksandra Nenadic University of Oxford Susanna-Assunta Sansone, Milo Thurston EMBL-EBI GOBLET UCL TGAC CBS DTU @ElixirTess


Download ppt "ELIXIR UK TeSS Training Portal"

Similar presentations


Ads by Google