Chapter 21 Genomes and Their Evolution

Chapter 21 Genomes and Their Evolution
Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Unit5: Molecular Basis of Inheritance

Concept 21.1: The Human Genome Project fostered development of faster, less expensive sequencing techniques Genomics: Study of sets of genes & interactions Bioinformatics: Application of computational methods to storage & analysis of biological data Human Genome Project,1990 Human genome mostly sequenced by 2003 Completed using sequencing machines and the dideoxy chain termination method Unit5: Molecular Basis of Inheritance

Development of Technology For Faster Sequencing
Chapter 21 Genomes and Their Evolution Development of Technology For Faster Sequencing Two approaches complemented each other in obtaining the complete sequence Built on an earlier storehouse of human genetic information J. Craig Venter: Company sequenced entire genome using an alternative whole-genome shotgun approach: Cloning & sequencing fragments of randomly cut DNA Assembly into a single continuous sequence Widely used, Newer techniques  faster pace, lower cost Do not require a cloning step Metagenomics Approach: DNA from a group of species in an environmental sample is sequenced Unit5: Molecular Basis of Inheritance

Figure 1 Cut the DNA into overlapping fragments short enough for sequencing. 2 Clone the fragments in plasmid or other vectors. 3 Sequence each fragment. CGCCATCAGT AGTCCGCTATACGA ACGATACTGGT Figure Whole-genome shotgun approach to sequencing (step 3) CGCCATCAGT ACGATACTGGT 4 Order the sequences into one overall sequence with computer software. AGTCCGCTATACGA ⋯CGCCATCAGTCCGCTATACGATACTGGT⋯ Unit5: Molecular Basis of Inheritance

Concept 21.2: Scientists use bioinformatics to analyze genomes and their functions Human Genome Project Established databases Refined analytical software to make data available on the Internet Accelerated progress in DNA sequence analysis Unit5: Molecular Basis of Inheritance

Centralized Resources for Analyzing Genome Sequences
Chapter 21 Genomes and Their Evolution Centralized Resources for Analyzing Genome Sequences Bioinformatics resources are provided by a number of sources National Library of Medicine and the National Institutes of Health (NIH) created the National Center for Biotechnology Information (NCBI) European Molecular Biology Laboratory DNA Data Bank of Japan BGI in Shenzhen, China Unit5: Molecular Basis of Inheritance

Genbank NCBI database of sequences Doubles its data every ~18 months Software available to online visitors Search Genbank for: A specific DNA sequence A predicted protein sequence Common stretches of amino acids in a protein NCBI Website: Provides 3-D views of all protein structures that have been determined Unit5: Molecular Basis of Inheritance

Figure 21.3 WD40 - Sequence Alignment Viewer WD40 - Cn3D 4.1 CDD Descriptive Items Name: WD40 WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; Figure 21.3 Bioinformatics tools that are available on the Internet Unit5: Molecular Basis of Inheritance

Identifying Protein-Coding Genes and Understanding Their Functions
Chapter 21 Genomes and Their Evolution Identifying Protein-Coding Genes and Understanding Their Functions DNA sequences  Geneticists study genes directly Gene Annotation: Identifying protein coding genes within DNA sequences in a database Largely automated process Comparison of sequences of previously unknown genes with those of known genes in other species may help provide clues about their function Genes & Gene Expression at Systems Level Proteomics: Systematic study of full protein sets encoded by a genome Proteins, not genes, carry out most of cell functions Unit5: Molecular Basis of Inheritance

How Systems Are Studied: An Example
Chapter 21 Genomes and Their Evolution How Systems Are Studied: An Example Systems Biology Approach Applied to define gene circuits and protein interaction networks Example: Saccharomyces cerevisiae (Yeast) Used sophisticated techniques to disable pairs of genes one pair at a time  Double mutants Computer software mapped genes  “Functional map” of interactions Unit5: Molecular Basis of Inheritance

Figure 21.4 Translation and ribosomal functions Mitochondrial functions Peroxisomal functions RNA processing Glutamate biosynthesis Transcription and chromatin-related functions Metabolism and amino acid biosynthesis Nuclear- cytoplasmic transport Serine- related biosynthesis Nuclear migration and protein degradation Secretion and vesicle transport Vesicle fusion Amino acid permease pathway Figure 21.4 The systems biology approach to protein interactions Mitosis Protein folding and glycosylation; cell wall biosynthesis DNA replication and repair Cell polarity and morphogenesis Unit5: Molecular Basis of Inheritance

Application of Systems Biology to Medicine
Chapter 21 Genomes and Their Evolution Application of Systems Biology to Medicine Cancer Genome Atlas Project, 2010 Looked for common mutations in 3 types of cancer Compared gene sequences and expression in cancer versus normal cells Success  Extended to ten other common cancers Silicon and glass “chips” have been produced that hold a microarray of most known human genes Used to study gene expression patterns in patients suffering from various cancers or other diseases Unit5: Molecular Basis of Inheritance

Human Gene Microarray Chip
Chapter 21 Genomes and Their Evolution Human Gene Microarray Chip Figure 21.5 A human gene microarray chip Unit5: Molecular Basis of Inheritance

Concept 21.3: Genomes vary in size, number of genes, and gene density
Chapter 21 Genomes and Their Evolution Concept 21.3: Genomes vary in size, number of genes, and gene density 2013: ~4,300 genomes completely sequenced 4,000 bacteria, 186 archaea, and 183 eukaryotes Sequencing of over 9,600 genomes and over metagenomes is currently in progress Genome Size Bacteria and archaea range from 1 to 6 million base pairs (Mb) Eukaryotes are usually larger Most plants and animals have genomes greater than Mb; humans have 3,000 Mb Each domain: No systematic relationship between genome size and phenotype Unit5: Molecular Basis of Inheritance

Table 21.1 Table 21.1 Genome sizes and estimated numbers of genes Unit5: Molecular Basis of Inheritance

Number of Genes Free-living bacteria and archaea: 1,500-7,500 genes Unicellular fungi: ~5,000 genes Multicellular eukaryotes: Up to ~40,000 genes # genes NOT correlated to genome size Examples: C. elegans have 100 Mb and 20,100 genes Drosophila has 165 Mb and 14,000 genes Human genome: ~21,000 genes Vertebrate genomes can produce more than one polypeptide per gene because of alternative splicing of RNA transcripts Unit5: Molecular Basis of Inheritance

Figure 21.UN03 Bacteria Archaea Eukarya Genome size Most are 10–4,000 Mb, but a few are much larger Most are 1–6 Mb Number of genes 1,500–7,500 5,000–40,000 Gene density Lower than in prokaryotes (Within eukaryotes, lower density is correlated with larger genomes.) Higher than in eukaryotes Introns None in protein-coding genes Present in some genes Present in most genes of multicellular eukaryotes, but only in some genes of unicellular eukaryotes Figure 21.UN03 Summary of key concepts: genome size Other noncoding DNA Can exist in large amounts; generally more repetitive noncoding DNA in multicellular eukaryotes Very little Unit5: Molecular Basis of Inheritance

Gene Density and Noncoding DNA
Chapter 21 Genomes and Their Evolution Gene Density and Noncoding DNA Humans and other mammals have lowest gene density (# genes), in a given length of DNA Multicellular eukaryotes have many introns within genes and a large amount of noncoding DNA between genes Unit5: Molecular Basis of Inheritance

Concept 21.4: Multicellular eukaryotes have much noncoding DNA and many multigene families Human genome sequence reveals 98.5% does not code for proteins, rRNAs, or tRNAs ~25% human genome codes for introns and gene- related regulatory sequences Intergenic DNA: Noncoding DNA between genes Pseudogenes: Former genes that have mutations and are nonfunctional Repetitive DNA: Multiple copies in the genome ~75% made up of transposable elements and related sequences Noncoding DNA plays important roles in cell Ex: Genomes of humans, rats, and mice show high sequence conservation for about 500 noncoding regions Unit5: Molecular Basis of Inheritance

Figure 21.6 Exons (1.5%) Regulatory sequences (5%) Introns (∼20%) Repetitive DNA that includes transposable elements and related sequences (44%) Unique noncoding DNA (15%) L1 sequences (17%) Repetitive DNA unrelated to transposable elements (14%) Figure 21.6 Types of DNA sequences in the human genome Alu elements (10%) Simple sequence DNA (3%) Large-segment duplications (5–6%) Unit5: Molecular Basis of Inheritance

Transposable Elements and Related Sequences
Chapter 21 Genomes and Their Evolution Transposable Elements and Related Sequences Mobile DNA Segments Geneticist Barbara McClintock’s breeding experiments with Indian corn Identified changes in color of kernels that made sense only if some genetic elements move from other genome locations into the genes for kernel color Transposable Elements: Move from one site to another in a cell’s DNA Present in both prokaryotes and eukaryotes Unit5: Molecular Basis of Inheritance

Effect Of Transposable Elements On Corn Kernel Color
Chapter 21 Genomes and Their Evolution Effect Of Transposable Elements On Corn Kernel Color Figure 21.7 The effect of transposable elements on corn kernel color Unit5: Molecular Basis of Inheritance

Movement of Transposons and Retrotransposons
Chapter 21 Genomes and Their Evolution Movement of Transposons and Retrotransposons Eukaryotic transposable elements are of two types Transposons, which move by means of a DNA intermediate and require a transposase enzyme Retrotransposons, which move by means of an RNA intermediate, using a reverse transcriptase Unit5: Molecular Basis of Inheritance

Figure 21.8 New copy of transposon Transposon DNA of genome Transposon is copied Insertion Figure 21.8 Transposon movement Mobile copy of transposon Unit5: Molecular Basis of Inheritance

Figure 21.9 New copy of retrotransposon Retrotransposon Synthesis of a single-stranded RNA intermediate RNA Insertion Reverse transcriptase Figure 21.9 Retrotransposon movement DNA strand Mobile copy of retrotransposon Unit5: Molecular Basis of Inheritance

Sequences Related to Transposable Elements
Chapter 21 Genomes and Their Evolution Sequences Related to Transposable Elements Copies of transposable elements and related sequences scattered throughout eukaryotic genomes Primates: Large portion of transposable element– related DNA consists of Alu elements (family of similar sequences) Many transcribed into RNA molecules Help regulate gene expression Human genome contains sequences of a LINE-1(L1) retrotransposon L1 sequences: Low rate of transposition & may effect gene expression May play roles in diversity of neuronal cell types Unit5: Molecular Basis of Inheritance

Other Repetitive DNA, Including Simple Sequence DNA
Chapter 21 Genomes and Their Evolution Other Repetitive DNA, Including Simple Sequence DNA ~15% of human genome consists of duplication of long sequences of DNA from one location to another Simple sequence DNA: Common in centromeres and telomeres  Structural roles in chromosomes Contains many copies of tandemly repeated short sequences Short tandem repeat (STR): Series of repeating units 2 to 5 nucleotides Repeat # for STRs varies among sites within a genome or individuals Unit5: Molecular Basis of Inheritance

Genes and Multigene Families
Chapter 21 Genomes and Their Evolution Genes and Multigene Families Eukaryotic genes present in one copy per haploid set of chromosomes Multigene Families: Genes occur in collections of identical or very similar genes Some consist of identical DNA sequences  Clustered tandemly  Code for rRNA products Nonidentical multigene families: Related families of genes that encode globins -globins and -globins: Polypeptides of hemoglobin Coded by genes on different human chromosomes Expressed at different times in development Unit5: Molecular Basis of Inheritance

Figure 21.10a Direction of transcription DNA RNA transcripts Nontranscribed spacer Transcription unit DNA 18S 5.8S 28S rRNA Figure 21.10a Gene families (part 1: ribosomal RNA family) 5.8S 28S 18S (a) Part of the ribosomal RNA gene family Unit5: Molecular Basis of Inheritance

Figure 21.10b β-Globin α-Globin α-Globin β-Globin Heme α-Globin gene family β-Globin gene family Chromosome 16 Chromosome 11 ζ ζ α 2 α 1 α2 α1 θ ϵ G A β  β Figure 21.10b Gene families (part 2: α-globin and β-globin families) Fetus and adult Embryo Embryo Fetus Adult (b) The human α-globin and β-globin gene families Unit5: Molecular Basis of Inheritance

Concept 21.5: Duplication, rearrangement, and mutation of DNA contribute to genome evolution Mutation: Change at the genomic level  Evolution Earliest life forms likely only had genes necessary for survival and reproduction Genome size increased over time Extra genetic material providing raw material for gene diversification Unit5: Molecular Basis of Inheritance

Duplication of Entire Chromosome Sets
Chapter 21 Genomes and Their Evolution Duplication of Entire Chromosome Sets Evolution of Genes with Novel Functions Accidents in Meiosis Polyploidy: 1 or more extra sets of chromosomes Genes in 1 or more of the extra sets can diverge by accumulating mutations Variations persist if organism carrying them survives and reproduces Unit5: Molecular Basis of Inheritance

Alterations of Chromosome Structure
Chapter 21 Genomes and Their Evolution Alterations of Chromosome Structure Comparative analysis between chromosomes of humans and 7 mammalian species Provides hypothetical chromosomal evolutionary history Humans: 23 pairs of chromosomes Chimpanzees: 24 pairs of chromosomes Divergence of humans and chimpanzees from a common ancestor: 2 chromosomes fused in humans Unit5: Molecular Basis of Inheritance

Figure 21.11 Human chromosome Chimpanzee chromosomes Telomere sequences Centromere sequences Telomere-like sequences 12 Centromere-like sequences Figure Human and chimpanzee chromosomes 2 13 Unit5: Molecular Basis of Inheritance

Figure 21.12 Human chromosome Mouse chromosomes Figure Human and mouse chromosomes 16 7 8 16 17 Unit5: Molecular Basis of Inheritance

Mistakes During Meiotic Recombination
Chapter 21 Genomes and Their Evolution Mistakes During Meiotic Recombination Duplications and Inversions Rate seems to have accelerated ~100 million y.a. Coincides with when large dinosaurs went extinct Mammals diversified Chromosomal rearrangements contribute to generations of new species Unit5: Molecular Basis of Inheritance

Duplication and Divergence of Gene-Sized Regions of DNA
Chapter 21 Genomes and Their Evolution Duplication and Divergence of Gene-Sized Regions of DNA Unequal crossing over during Prophase I 1 chromosome with a deletion Other with a duplication of a particular region Transposable Elements: Provide sites for crossover between non-sister chromatids Unit5: Molecular Basis of Inheritance

Figure 21.13 Nonsister chromatids Gene Transposable element Crossover point Incorrect pairing of two homologs during meiosis Figure Gene duplication due to unequal crossing over and Unit5: Molecular Basis of Inheritance

Evolution of Genes with Related Functions: Human Globin Genes
Chapter 21 Genomes and Their Evolution Evolution of Genes with Related Functions: Human Globin Genes Genes encoding various globin proteins evolved from one common ancestral globin gene Duplicated & diverged ~450–500 million y.a. Accumulation of mutations  Differences between genes in globin family arose from the Subsequent duplications & random mutations  present globin genes Code for oxygen-binding proteins Evidence: Similarity in amino acid sequences of globin proteins Unit5: Molecular Basis of Inheritance

Figure 21.14 Ancestral globin gene Duplication of ancestral gene Mutation in both copies α β Transposition to different chromosomes Evolutionary time α β Further duplications and mutations ζ α ϵ  β Figure A model for the evolution of the human α-globin and β-globin gene families from a single ancestral globin gene ζ ζ α 2 α 1 α2 α1 yθ ϵ G A β  β α-Globin gene family on chromosome 16 β-Globin gene family on chromosome 11 Unit5: Molecular Basis of Inheritance

Evolution of Genes with Novel Functions
Chapter 21 Genomes and Their Evolution Evolution of Genes with Novel Functions Copies of duplicated genes diverge  Functions of encoded proteins becomes very different Example: Lysozyme Gene Duplicated and evolved into gene encoding for -lactalbumin in mammals Lysozyme: Enzyme that protects animals against bacterial infection -lactalbumin: Nonenzymatic protein Plays role in milk production in mammals Unit5: Molecular Basis of Inheritance

Figure 21.15 (a) Lysozyme (b) α–lactalbumin Lysozyme 1 α–lactalbumin 1 Figure Comparison of lysozyme and α-lactalbumin proteins Lysozyme 51 α–lactalbumin 51 Lysozyme 101 α–lactalbumin 101 (c) Amino acid sequence alignments of lysozyme and α–lactalbumin Unit5: Molecular Basis of Inheritance

Rearrangements of Parts of Genes: Exon Duplication and Exon Shuffling
Chapter 21 Genomes and Their Evolution Rearrangements of Parts of Genes: Exon Duplication and Exon Shuffling Duplication or repositioning of Exons Contributed to genome evolution Errors in Meiosis Exon duplicated on one chromosome Deleted from the homologous chromosome Exon Shuffling: Errors in meiotic recombination  Mixing and matching of exons Within a gene or between 2 nonallelic genes Unit5: Molecular Basis of Inheritance

Figure 21.16 EGF EGF EGF EGF Epidermal growth factor gene with multiple EGF exons Exon shuffling Exon duplication F F F F Fibronectin gene with multiple “finger” exons F EGF K K Figure Evolution of a new gene by exon shuffling K Exon shuffling Plasminogen gene with a “kringle” exon Portions of ancestral genes TPA gene as it exists today Unit5: Molecular Basis of Inheritance

How Transposable Elements Contribute to Genome Evolution
Chapter 21 Genomes and Their Evolution How Transposable Elements Contribute to Genome Evolution Multiple copies of Similar Transposable Elements Facilitate recombination, or crossing over, between different chromosomes Insertion of transposable elements Within a protein-coding sequence: Block production Within a regulatory sequence: Increase or decrease protein production Transposable elements carry a gene or groups of genes to a new position May also create new sites for alternative splicing in RNA transcript Changes usually detrimental but may be advantageous Unit5: Molecular Basis of Inheritance

Concept 21.6: Comparing genome sequences provides clues to evolution and development Comparing genomes of different species provides data about evolutionary history Comparative Studies Embryonic Development Clarify mechanisms that generate diversity of present life-forms Genomes of Closely Related Species Provide understanding of recent evolutionary events Cladogram or Phylogenetic Tree: Demonstrates the relationships among species Unit5: Molecular Basis of Inheritance

Figure 21.17 Bacteria Most recent common ancestor of all living things Eukarya Archaea Billions of years ago Chimpanzee Human Figure Evolutionary relationships of the three domains of life Mouse Millions of years ago Unit5: Molecular Basis of Inheritance

Comparing Distantly Related Species
Chapter 21 Genomes and Their Evolution Comparing Distantly Related Species Highly conserved genes changed very little Help clarify relationships among species that diverged long ago Bacteria, archaea, and eukaryotes diverged from each other ~2-4 billion y.a. Studied in one model organism Results applied to other organisms Unit5: Molecular Basis of Inheritance

Comparing Closely Related Species
Chapter 21 Genomes and Their Evolution Comparing Closely Related Species Genomes of closely related species are likely to be organized similarly For example, using the human genome sequence as a guide, researchers were quickly able to sequence the chimpanzee genome Analysis of the human and chimpanzee genomes reveals some general differences that underlie the differences between the two organisms Unit5: Molecular Basis of Inheritance

Human and Chimpanzee Genomes
Chapter 21 Genomes and Their Evolution Human and Chimpanzee Genomes Differ by 1.2% at single base-pairs & 2.7% because of insertions and deletions Sequencing Bonobo Genome, 2012 Some regions have greater similarity between human and bonobo, or human and chimpanzee sequences, than between chimpanzee and bonobo Expression of FOXP2 Gene: Product turns on genes involved in vocalization Differences may explain why humans but not chimpanzees communicate by speech FOXP2 gene of Neanderthals identical to humans Suggests capability of speech Unit5: Molecular Basis of Inheritance

Figure 21.18a Experiment Wild type: two normal copies of FOXP2 Heterozygote: one copy of FOXP2 disrupted Homozygote: both copies of FOXP2 disrupted Experiment 1: Researchers cut thin sections of brain and stained them with reagents that allow visualization of brain anatomy in a UV fluorescence microscope. Results Experiment 1 Figure 21.18a Inquiry: What is the function of a gene (FOXP2) that is rapidly evolving in the human lineage? (part 1: experiment 1) Wild type Heterozygote Homozygote Unit5: Molecular Basis of Inheritance

Figure 21.18b Experiment Wild type: two normal copies of FOXP2 Heterozygote: one copy of FOXP2 disrupted Homozygote: both copies of FOXP2 disrupted Experiment 2: Researchers separated each newborn pup from its mother and recorded the number of ultrasonic whistles produced by the pup. Results Experiment 2 400 300 Figure 21.18b Inquiry: What is the function of a gene (FOXP2) that is rapidly evolving in the human lineage? (part 2: experiment 2) Number of whistles 200 100 (No whistles) Wild type Hetero- zygote Homo- zygote Unit5: Molecular Basis of Inheritance

Evolution Rates of Genes
Chapter 21 Genomes and Their Evolution Evolution Rates of Genes Some genes are evolving faster in humans than chimpanzees or mice: Defenses against malaria and tuberculosis Regulation of brain size Unit5: Molecular Basis of Inheritance

Comparing Genomes Within a Species
Chapter 21 Genomes and Their Evolution Comparing Genomes Within a Species As a species, humans have only been around about 200,000 years and have low within-species genetic variation Variation within humans is due to single nucleotide polymorphisms, inversions, deletions, and duplications Most surprising is the large number of copy-number variants These variations are useful for studying human evolution and human health Unit5: Molecular Basis of Inheritance

Widespread Conservation of Developmental Genes Among Animals
Chapter 21 Genomes and Their Evolution Widespread Conservation of Developmental Genes Among Animals Evolutionary Developmental Biology, Evo-Devo Minor differences in gene sequence or regulation can result in striking differences in form Molecular analysis of the homeotic genes in Drosophila: All contain homeobox sequence Identical, or very similar, nucleotide sequence discovered in the homeotic genes of vertebrates and invertebrates Homebox Genes: Code for domain that allows a protein to bind to DNA and function as transcription regulator Unit5: Molecular Basis of Inheritance

Figure 21.19 Adult fruit fly Fruit fly embryo (10 hours) Fruit fly chromosome Mouse chromosomes Mouse embryo (12 days) Figure Conservation of homeotic genes in a fruit fly and a mouse Adult mouse Unit5: Molecular Basis of Inheritance

Homeotic Genes Hox genes: Homeotic genes in animals Related homeobox sequences found in regulatory genes of yeasts, plants, and prokaryotes Many other developmental genes highly conserved from species to species Small changes in regulatory sequences of certain genes lead to major changes in body form Example: Variation in Hox gene Expression Controls variation in leg-bearing segments of crustaceans and insects In other cases, genes with conserved sequences play different roles in different species Unit5: Molecular Basis of Inheritance

Figure 21.20 Genital segments Thorax Abdomen (a) Expression of four Hox genes in the brine shrimp Artemia Thorax Abdomen Figure Effect of differences in Hox gene expression in crustaceans and insects (b) Expression of the grasshopper versions of the same four Hox genes Unit5: Molecular Basis of Inheritance

Figure 21.UN01c β α α Figure 21.UN01c Skills exercise: reading an amino acid sequence identity table (part 3) β Hemoglobin Unit5: Molecular Basis of Inheritance

Lab Preparation: Online Activities
“The Evolution of Flight in Birds” ons/reslab/flight/main.htm This activity provides a real-world example of how cladograms are used to understand evolutionary relationships. “What did T. rex taste like?” ons/tours/Trex/index.html “Journey into Phylogenetic Systematics”

Chapter 21 Genomes and Their Evolution

Similar presentations

Presentation on theme: "Chapter 21 Genomes and Their Evolution"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Chapter 21 Genomes and Their Evolution

Similar presentations

Presentation on theme: "Chapter 21 Genomes and Their Evolution"— Presentation transcript:

Similar presentations

About project

Feedback