Presentation is loading. Please wait.

Presentation is loading. Please wait.

(3) Gene Expression Gene Expression (A) What is Gene Expression?

Published byCarmella Tate Modified over 6 years ago

Similar presentations

Presentation on theme: "(3) Gene Expression Gene Expression (A) What is Gene Expression?"— Presentation transcript:

1 (3) Gene Expression Gene Expression (A) What is Gene Expression?
(E) Splicing and post-translational modification (B) Structure and Functions of RNA (D) Translation (C) Transcription

2 Gene Expression (D) State where translation occurs
State what mRNA is translated into State what is meant by an ‘anti-codon’ State 2 features of the tRNA folded structure Explain briefly how the sequence of amino acids is formed Describe the process of translation State where start and stop codons are found and what their functions are Name the bond formed between amino acids State what happens to tRNA molecules as the polypeptide chain is formed during translation

3 Codons Codons are the basic unit for the genetic code
Bases are taken in groups of 3 giving 64 (43) different combinations. Each amino acid is coded for by one of these 64 triplets of bases

4 Structure of tRNA (2D vs 3D)

5 Structure of tRNA tRNA molecules are shaped like a four leaf clover so that: One side can bind to mRNA ( anti- codon) Second side binds to ribosome Third side binds to a specific amino acid Fourth side binds to enzymes controlling the process

6 tRNA The tRNA molecule folds up due to base pairing. By doing so, it forms: A triplet anticodon site (this is where the complementary codon will match up with it) An attachment site for a specific amino acid. The anti-codon on a tRNA molecule corresponds to a specific amino acid. There are 20 different types of amino acids, therefore there are also 20 types of tRNA molecules. AA 1 G C U ANTI-codon

7 Translation – Importance of Sequence
Triplet codons on mRNA and anticodons on the tRNA translate the genetic code into a sequence of amino acids. This sequence of amino acids dictates the structure of the protein to be made

8 Cell Ultra structure Ribosomes Site of protein synthesis

9

10 Ribosomes Found freely in the cytoplasm AND on the ROUGH endoplasmic reticulum Translation of mRNA into a polypeptide by tRNA occurs at the ribosome.

11 Pathway to making a protein
DNA RNA Protein a mRNA molecule is made (transcribed) from a portion of DNA and then carried to the cytoplasm transcription translation occurs when the sequence of bases of mRNA DIRECTS the sequence of amino acids in a protein RIBOSOME – site of protein synthesis Translation ANIMATION

12 Peptide bond forms between amino acids Amino Acid
U G C aa2 tRNA bringing in specific amino acid to the ribosome A U aa7 tRNA bringing in specific amino acid to the ribosome Codon anticodon link Codon on mRNA AntiCodon on tRNA U A C G mRNA

13 tRNA returning to cytoplasm for another amino acid
aa4 aa3 A U aa7 C G U aa5 U C A aa6 U A U C C U U G C tRNA returning to cytoplasm for another amino acid aa2 Peptide bond forms between amino acids U G A aa9 aa7 U G C aa2 A U U A C G

14 aa4 aa3 A U aa7 C G U aa5 A U C aa6 U A U C C U aa2 U G C aa2 aa7 U G A aa9 U G C U A C G

15 A U aa7 U aa4 aa3 C G U aa5 U C C U aa2 U G C A U C aa6 aa2 aa7 aa9 U G A U A C G

16 To see an excellent animation of this from DNA tube click here
aa7 aa3 G U C aa5 U C C U aa2 U G C To see an excellent animation of this from DNA tube click here U aa4 aa6 aa2 aa7 aa9 A U C U A C G

17 Translation Step 1: The mature mRNA transcript enters the cytoplasm and attaches to a ribosome The mRNA transcript contains a start codon and stop codon Translation always occurs in the 5’ to 3’ direction

18 Translation Step 2: tRNA molecules pick up specific amino acids in the cytoplasm

19 Translation Step 3: tRNAs carrying amino acids align their anticodon beside the complementary codon on the mRNA

20 Translation Step 4: Peptide bonds form between adjacent amino acids
The tRNA molecule leaves the ribosome and return to the cytoplasm (where it can pick up more of the specific amino acids if required)

21 Translation Step 5: the polypeptide chain continues to grow
Poly = many; peptide = the bond formed between 2 AAs

22 Translation Step 6: Eventually, a stop codon on the mRNA is reached. This is when the polypeptide becomes released from the ribosome

23 VIDEO: translation

24 Start and Stop Codons In human cells the START codon is always AUG which codes for the amino acid (Met/M) Methionine . There is also a ‘stop’ codon which completes the process

25

26 Start and Stop Codons GCGTTTGAAGATGATCAGTTAGAAACT
TASK: Write the correct sequence of Amino Acids which would translated from the following DNA strand: GCGTTTGAAGATGATCAGTTAGAAACT mRNA: CGCAAACUUCUACUAGUCAAUCUUUGA Amino acid that is carried by the tRNA: STOP Arginine Leucine Lysine Leucine Valine Leucine Leucine Asparagine

27 Gene Expression (D) State where translation occurs
State what mRNA is translated into State what is meant by an ‘anti-codon’ State 2 features of the tRNA folded structure Explain briefly how the sequence of amino acids is formed Describe the process of translation State where start and stop codons are found and what their functions are Name the bond formed between amino acids State what happens to tRNA molecules as the polypeptide chain is formed during translation

Download ppt "(3) Gene Expression Gene Expression (A) What is Gene Expression?"

Similar presentations

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.
Cell Protein Production

Cell Protein Production
From gene to protein. DNA:nucleotides are the monomers Proteins: amino acids are the monomers DNA:in the nucleus Proteins:synthesized in cytoplasm.

From gene to protein. DNA:nucleotides are the monomers Proteins: amino acids are the monomers DNA:in the nucleus Proteins:synthesized in cytoplasm.
PROTEIN SYNTHESIS.

PROTEIN SYNTHESIS.
DNA and Protein Synthesis. DNA Does 2 Important Things in a Cell: 1)DNA is capable of replicating itself. Every time a cell divides, each DNA strand makes.

DNA and Protein Synthesis. DNA Does 2 Important Things in a Cell: 1)DNA is capable of replicating itself. Every time a cell divides, each DNA strand makes.
Activate Prior Knowledge

Activate Prior Knowledge
Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
Protein Synthesis Mrs Griffiths AS Biology. Protein synthesis pg 72-73 1. DNA unwinds 2. mRNA copy is made of one of the DNA strands. 3. mRNA copy moves.

Protein Synthesis Mrs Griffiths AS Biology. Protein synthesis pg DNA unwinds 2. mRNA copy is made of one of the DNA strands. 3. mRNA copy moves.
Protein Synthesis: Translation Making the Protein from the Code.

Protein Synthesis: Translation Making the Protein from the Code.
Chapter 13: RNA and Protein Synthesis

Chapter 13: RNA and Protein Synthesis
RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.
CFE Higher Biology DNA and the Genome Translation.

CFE Higher Biology DNA and the Genome Translation.
SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
Transcription and Translation.  Genes: are segments of DNA that code for proteins  Most nucleotide base sequences in DNA don’t code for anything  ATGCGAATCGTAGCATACGATGCATGCACGTG.

Transcription and Translation.  Genes: are segments of DNA that code for proteins  Most nucleotide base sequences in DNA don’t code for anything  ATGCGAATCGTAGCATACGATGCATGCACGTG.
DNA / RNA. tRNA rRNA mRNA 5’ 3’ Types of RNA Transcription: transfer of information from DNA to RNA in the nucleus  In the process of transcription.

DNA / RNA. tRNA rRNA mRNA 5’ 3’ Types of RNA Transcription: transfer of information from DNA to RNA in the nucleus  In the process of transcription.
Pharmaceutical Biotechnology. Protein Synthesis Recombinant DNA Technology.

Pharmaceutical Biotechnology. Protein Synthesis Recombinant DNA Technology.
Chapter 8 Section 8.5: Translation 1. Objectives SWBAT describe how mRNA codons are translated into amino acids. SWBAT summarize the process of protein.

Chapter 8 Section 8.5: Translation 1. Objectives SWBAT describe how mRNA codons are translated into amino acids. SWBAT summarize the process of protein.

Similar presentations

Ads by Google