1. Welcome to an OpenHelix tutorial.
Copyright OpenHelix. No use or reproduction without express written consent

2. Important note to slide users:
PC users
Mac users
To maintain the color schemes/cues and the animations, if you import these slides into other slide sets please click the checkbox in the PowerPoint Insert window that maintains slide format. Otherwise important information may be lost.
To maintain the color schemes/cues and the animations, if you import these slides into other slide sets please click the checkbox in the PowerPoint Insert window that maintains slide format. Otherwise important information may be lost.
Copyright OpenHelix. No use or reproduction without express written consent

3. The UCSC Genome Browser Additional Tools
Materials prepared by
Warren C. Lathe III, Ph.D.
Mary Mangan, Ph.D.
Updated: Q4 2010
Welcome to the Additional Tools tutorial on the UCSC Genome Browser.
The UCSC Genome Browser contains the reference (or official) public DNA sequences, and working draft assemblies, for human and a large collection of other genomes. There are a number of tools within this site that will provide access to the sequences themselves, and many other useful genome features and data types to add context to the genomic information. Researchers use this site to find genes and gene predictions, expression information, SNPs and variations, cross-species comparative data, and much more.
The main features of the UCSC Genome Browser are explored in introductory and advanced tutorials that are also available on this site. We encourage you to familiarize yourself with that material before proceeding to the Additional Tools materials. This tutorial assumes that the viewer has sufficient background information to move forward with these additional interfaces and strategies.
This tutorial was created by Doctors Mary Mangan and Warren Lathe of OpenHelix. It is freely available to everyone because it is sponsored by the UCSC Genome Bioinformatics group.
Version18c
Copyright OpenHelix. No use or reproduction without express written consent

4. UCSC Genome Browser Agenda
Introduction
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
The agenda for this tutorial is shown here.
We start with a brief introduction about access to these tools, and will move on to explore the tools separately.
We will introduce the Gene Sorter.
We will demonstrate the in silico PCR interface.
We will examine the VisiGene image data.
We will explore the Proteome Browser.
We’ll mention some other features at the site.
Finally, you will have the opportunity to watch as we perform a sample exercise on the UCSC Genome Browser site, to reinforce the concepts developed in this tutorial.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

5. The UCSC Homepage: http://genome.ucsc.edu
The UCSC Genome Browser is an extensive resource that provides access to genomic data. Many species genomes can be searched, and the data can be displayed and retrieved using the standard interfaces for basic searches. In addition, access to the underlying database is provided by the Table Browser interface. The Table Browser permits advanced query types and a variety of output strategies which can be especially helpful for large scale queries.
However, in addition to the core functions for the access and display of genomic data, the UCSC Genome Browser team has created additional tools that can be used to explore in a variety of other ways. This tutorial will introduce you to these data types and tools that supplement the core functions.
This tutorial assumes that the user is already familiar with the introductory and advanced materials offered as part of the UCSC Genome Browser training suite. We will explore these supplementary tools on that framework, and we will not cover the basic foundations in this section.
Copyright OpenHelix. No use or reproduction without express written consent

6. UCSC Genome Browser Agenda
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
[end of Introduction] That completes our Introduction.
[beginning of Gene Sorter] In this section we will examine the Gene Sorter tool.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

7. Gene Sorter From homepage select “Gene Sorter” 7
The Gene Sorter allows you to sort genes by similarity to a reference gene. The Gene Sorter can be a power search tool for analysis of your gene in question or to find genes that might be of interest to your research.
You can use the navigation bars at the top or at the side of the UCSC home page to access the Gene Sorter. Select and click one of the links called Gene Sorter to get started.
These will bring you to a Gene Sorter web page, as shown in the next slide.
Copyright OpenHelix. No use or reproduction without express written consent 7 7

8. Gene Sorter Example Sort genes by similarity criteria 8
Here, I am showing you the results of a search to give you an idea of what the Gene Sorter does.
The Gene Sorter takes a gene of interest and lists other genes in the genome sorted by a similarity type to the reference gene you chose. Each gene listed also has columns of data about that gene and the genes can be filtered to limit the search.
Now, let’s take a look at how to get to these results.
Sort genes by
similarity criteria
Copyright OpenHelix. No use or reproduction without xpress written consent 8 8

9. Gene Sorter: Chose Genome and Gene
Type in gene name or accession number
Choose Assembly
Choose Genome
Here is the interface you first come to when you click that “Gene Sorter” link.
When you first approach the Gene Sorter, you are given several choices. First, you must choose which species you want to search in. At this time, you can only search one genome at a time and the species choices are limited to some of the most used model species. We are going to choose “Human.”
Next you will choose which assembly you wish to search, the default will most often be the recent one. For this tutorial, we will choose the most recent one: March 2006.
Then you will add the gene name or accession number of the gene you want to sort by. Here we’ve added the accession number for the BRCA1 gene: NM underscore If we had entered a gene name or keyword, the program would have given us a list of all gene records that contain that name or keyword for you to choose from.
Copyright OpenHelix. No use or reproduction without express written consent 9 9

10. Gene Sorter: Similarity Sorting Options
Choose from several similarity sorting options, varies by assembly & species
Your next major choice is by what criteria do you wish to seek similarity to the gene in question. You have several choices of pre-calculated similarity sorting options. For example, some of these include similarity in expression patterns, protein homology, Pfam domain structure, gene distance, name, Gene Ontology similarity and others. We will choose a BLASTP protein similarity to search and sort by.
Just a side note, other assemblies of this species and other species will have different similarity sorting options than the ones shown here.
Copyright OpenHelix. No use or reproduction without express written consent 10 10

11. Gene Sorter: Configure
Your next option is to configure the display to add, subtract and change data columns. Click the “configure” button. The configuration page will appear.
Some columns of data will be checked by default, or you may change the configuration of the resulting data, adding more columns of data. For example you can add a column of Gene Ontology terms for each gene in the family, or the best mouse ortholog.
You can also change the position in the table that the column appears.
Some data columns can be configured further. For example, the GNF Atlas 2 expression data column can be configured to show all tissues or a selected set, or have the values to be absolute or a ratio to the mean level of expression.
Choose order of display columns
Some columns can be configured
Choose columns of data to display
Copyright OpenHelix. No use or reproduction without express written consent 11 11

12. Gene Sorter: Saving Configuration
Configure
Hide, show all columns or return to default
Save configurations and load previous
You can hide all data columns which would be useful if you wanted to choose specific columns and eliminate default or other previous choices. You can choose to show all data columns or if you need to, return to the default columns.
You can also save the data column configurations you have chosen for future viewing. We’ll discuss this more fully in the filters section since the behavior for both is the same.
Copyright OpenHelix. No use or reproduction without express written consent 12 12

13. Gene Sorter: Adding Custom Data
Configure
Custom data
There are a few other things you can change such as the colors that signify the level of expression in expression data columns and a toggle to show all splice variants also.
A new feature that has been added is the ability to add columns of data that are user-generated. This button will take you to a page to upload your custom column and a link to find out how to format your column. This is beyond the scope of this tutorial, but if you are interested, the help section is straightforward and should be simple to follow.
Custom columns of user’s data
Copyright OpenHelix. No use or reproduction without express written consent 13 13

14. Gene Sorter: Filters
List genes
Filter
The next option in your search is to filter the resulting genes that are sorted. This is a powerful feature that allows you to find exactly those genes that might be of interest in your research.
Clicking the “filter” button will take you to the filter page.
Here you will find that you can filter any column of data. Shown here are only the first few displayed columns. If we were able to show the entire list, you’d see that there are filter boxes for every column of data including those that you have chosen to display in the results and those you haven’t.
For example, you could filter for only genes with gene names that have a specific text string or genes that have a certain minimum or maximum level of expression. For many data column filters, you can paste in or upload a list of filters if you have a large filter list.
Once you choose your filters, you can list the resulting genes by name. This will be a text list of all the gene names your search will find listed alphabetically. This can be helpful to get an idea how large your results list will be, decide if you need to tighten or loosen your filters, or make sure you are getting the genes you are expecting.
Filter data of columns displayed or those not displayed
List all genes found with selected filters
Copyright OpenHelix. No use or reproduction without express written consent 14 14

15. Gene Sorter: Save Filters
trim_name
Click save
You are also able to save your filters for later use. We saw this in the configuration options and the actions are the same.
We are going to put in a filter for only gene names starting with the string “trim” with a wildcard asterisk. That will pull up any gene with “trim” at the beginning of the name such as Trim31 or Trim5.
Click the “save filter” button after you have selected or uploaded your filters. This will take you to a simple box where you name the filter. Type in a name for your filter set, here we’ve typed in “trim underscore name” to remind us it is a filter on the gene name for “trim.” Then we click save.
It’s simple as that. Your filter choices are now saved in the cookies of your browser for you to view at a future time.
Copyright OpenHelix. No use or reproduction without express written consent 15 15 15 15

16. Gene Sorter: Load Filters
Saved filters
Choose filter & load
To load your saved filters, just click the active “load filter” button and a list of your saved filters will appear.
Here I am showing an example where I’ve saved two different filter sets. The one we just did filtering on gene names for the string “trim” and a previous one where I filtered for genes with a high level of fetal brain tissue expression. We’ll highlight the one we just did, “trim name,” and click “load.”
The filter for gene names will now be loaded.
Copyright OpenHelix. No use or reproduction without express written consent 16 16

17. Gene Sorter: Submit Filters
Click the submit button to add filters to your search and show results.
Copyright OpenHelix. No use or reproduction without express written consent 17 17

18. Gene Sorter: Get Results
Go to results
Once you submit your filter the results should show. If not, you can click the “Go!” button to get results.
You will now see results based on your reference gene, sorted by protein similarity using BLASTP, configured with the data display you chose and filtered based on gene names that start with the text string “trim.” As you’ll notice here, the results now do not include the BRCA1 gene since it does not start with “trim,” but the results are sorted by protein similarity to the BRCA1 gene protein product.
Copyright OpenHelix. No use or reproduction without express written consent 18 18

19. Gene Sorter: Sort Results by Name
Description
Re-sort genes based on gene clicked using same parameters.
There is a lot you can now do in the displayed columns to get more information about the sorted genes.
Shown here are the default columns of data. If we had chosen other data columns, we would have been able to find information about that data. We’ll go through these columns to give you an idea of what you can do.
The gene “Name” column lists the names of the genes. If you click on the column heading “Name” you will get a page of description about the data and the action that you can perform in that column. This is true of all column headings. All will have a description and action performed. Many will also have information and links about how the data was obtained and credits.
The action that you can perform in the name column is to click on a specific gene name which will re-sort the genes based on that gene and the previous filters. Here we will click on TRIM5 as an example. This second screenshot demonstrates how the display would be changed after clicking TRIM5. We’ll hit the back button and stay with our original search, on BRCA1, for this tutorial.
Re-sort
Copyright OpenHelix. No use or reproduction without express written consent 19 19

20. Gene Sorter: VisiGene Results
Open UCSC VisiGene image page for gene.
The VisiGene link lists VisiGene data for each gene if it is available.
Clicking on the specific link, the VisiGene record for TRIM5 again, will take you to the UCSC VisiGene page for that gene. VisiGene is a UCSC browser for viewing in situ images, featuring a large data collection obtained from multiple external collaborators. We will be discussing VisiGene in greater detail later in this tutorial. Additionally the UCSC documentation has more about the VisiGene data.
Some columns of data, like this expression data from GNF Atlas2, do not link out to further data since the data is shown in the display. However, in the case of this expression data, you can find the exact numbers by downloaded a text file of the data. We’ll learn how to do that further along in this tutorial. You can also get more information about how the data was obtained and credits by clicking the column header.
VisiGene
Copyright OpenHelix. No use or reproduction without express written consent 20 20

21. Gene Sorter: Alignment Results
The BlastP E-Value column lists the E-value, or “Expectation Value” of the protein similarity. The greater the similarity of two proteins, the lower the E-value is. Identical long proteins have an E-value of zero. Since we sorted by protein similarity to BRCA1, you’ll notice the first E-value is the lowest, thus most similar, and they get progressively larger.
Clicking on a specific E-value will take you to an alignment of the peptide regions of BRCA1 and the listed gene (TRIM5 in this example) that are similar.
Amino acid alignment between reference gene and gene protein products
Alignment
Copyright OpenHelix. No use or reproduction without express written consent 21 21

22. Gene Sorter: Open Genome Browser
Open Genome Browser to location of chosen gene
The location column lists the genomic location of the gene and clicking on that link will open the UCSC Genome Browser to that location.
Browser
Copyright OpenHelix. No use or reproduction without express written consent 22 22

23. Gene Sorter: Open Details Page
Open gene details page of chosen gene
Lastly, at least for the default set of data columns, the descriptions of the genes are listed and clicking on a specific description will open the gene detail page for that gene.
Description
Copyright OpenHelix. No use or reproduction without express written consent 23 23

24. Gene Sorter: Gene Sequences
Get sequences
Choose sequence type, obtain FASTA file of all gene sequences
If you will notice, two new options become available when you have come to this screen, ‘sequence’ and ‘text’.
Clicking on “sequence” will take you to a format page. Here you can choose which sequence type you are interested in. We’ll choose “Protein.”
Clicking on “Get Sequence” will get you a FASTA formatted text file of all the genes in your search.
Copyright OpenHelix. No use or reproduction without express written consent 24 24

25. Gene Sorter: Text File of Data
Data text
Clicking “text” will get you a tab-delineated file of all the genes and the column data you have chosen to display. This can be saved on your computer and viewed in a program like Excel or other spreadsheet program.
Obtain tab-delineated file of all displayed gene data
Copyright OpenHelix. No use or reproduction without express written consent 25 25

26. Gene Sorter Sort genes by similarity criteria 26
We just briefly introduced you to the Gene Sorter. The Gene Sorter simply takes a gene of interest and sorts other genes in the genome based on similarity to that gene. The similarity can be expression, protein or more. Additionally, the genes sorted can be filtered to find exactly the genes you are searching for, and the display links out to more information about each of the genes.
It is a simple tool to use, but is a powerful search and analysis tool.
Sort genes by
similarity criteria
Copyright OpenHelix. No use or reproduction without express written consent 26 26

27. UCSC Genome Browser Agenda
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
[end of Gene Sorter] That completes our look at the Gene Sorter.
[beginning of in silico PCR] In this section we will examine the in silico PCR tool.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

28. In-Silico PCR: Find Sequence Between Primers
TATTATGGTATAAGTTGGTGT
CTCTTCCAATGTTTCACCACAAC
Another tool available from the UCSC bioinformatics team is called In-Silico PCR. Clicking the PCR link from the homepage will provide the interface shown here.
In-Silico PCR searches a genomic sequence database with a pair of PCR primers. It uses an indexing strategy from the BLAT algorithm to do this quickly. When you enter primer sequences, which must be at least 15 bases long, you can obtain the corresponding genomic stretch that would be amplified between these two primers.
It is not a complicated tool—the first step is to select one genome and assembly. You may then determine if you want the sequence that corresponds to the genomic reference sequence (called genome assembly) or if you would like the sequence of possible transcript variants in the UCSC genes collection. Next, enter a forward primer, and enter a reverse primer.
The maximum product size is set by default for 4000 bases. However, you may adjust this. If you expect that may be too small of a genomic region you should increase this size. Sometimes if you aren’t seeing the results you expect you may want to check this. There could be a larger genomic span than you anticipated.
The primers must be at least 15 bases in length. You can set the perfect match and good match. The Perfect Match describes the number of bases that need to match exactly. The good match allows you to have a bit of variability on the 3 prime end. However, please note that this tool does not process ambiguous bases at this time. You may use only A, T, G, or C for your nucleotides.
You have the option to flip the reverse primer if you need to. If you haven’t already obtained the reverse orientation sequence for the second primer the software can accomplish this for you.
Here I show a couple of sample primer sequences, and I am choosing to let the software flip the reverse primer for me.
When you submit the query to the database, you will obtain the output page, which we will see in the next slide.
[ Not for audio (primers: TATTATGGTATAAGTTGGTGT and CTCTTCCAATGTTTCACCACAAC from TP53 genomic sequence)]
Select genome
Genomic or transcript?
Enter primers
Set configuration options
Flip reverse primer?
Submit
(note: the tool does not handle ambiguous bases at this time—don’t use Ns)
Copyright OpenHelix. No use or reproduction without express written consent

29. In-Silico PCR Results Genomic location shown, links to Genome Viewer
size
your primers
Tm for primers
The results of our sample In Silico PCR using the primer sequences I showed. You can see that there is an indication of where your match occurs at the top—which is linked back into the browser so you can see where the match is located.
The size of the predicted product is displayed (430 base pairs in this case).
The primers that were used are displayed (and the reverse one is flipped if you asked for that).
And, you see the sequence you should expect from PCR on genomic DNA. Your primers are displayed in the CAPITAL letters. If there had been more than one location amplified, the additional locations would be listed beneath the first one.
Also, you will find the melting temperatures of the primers displayed as well. This data is based on code from the Primer3 tool, with some standard settings for salt and oligo concentrations.
You can use the in silico PCR tool to identify the expected amplification product on genomic DNA, between your two chosen primers of interest.
Genomic location shown, links to Genome Viewer
Product size indicated
Your primers displayed, flipped if necessary
Predicted genomic sequence shown
Primer melting temperatures provided
Copyright OpenHelix. No use or reproduction without express written consent

30. UCSC Genome Browser Agenda
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
[end of in silico PCR] That completes our look at in silico PCR.
[beginning of in VisiGene] In this section we will examine the VisiGene Browser.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

31. VisiGene Image Browser
Another tool associated with the UCSC Genome Browser is the VisiGene Image Browser of in situ image data. The browser serves as a virtual microscope, allowing users to retrieve images that meet specific search criteria, then interactively zoom and scroll across the collection.
VisiGene gathers images from a number of sources: The Gene Expression Database at the Jackson Laboratory, The GenSat collection at NCBI, the Mahoney Center for Neuro-Oncology mouse transcription factors, the National Institute for Basic Biology in Japan’s collection of Xenopus embryos, and images from the Allen Brain Atlas collection.
You will use VisiGene to search for images that illustrate gene expression data in cells and tissues, at the RNA or protein level.
The simple search form—where you can enter a gene symbol, author, body parts or stages of development, several types of IDs, is shown here. I will demonstrate a simple search for a gene symbol. We will search for Mtap4. The result will be shown next.
VisiGene: Biological image data
Expression in cells and tissues; mRNA or protein
Search by symbol, author, body parts, IDs, stages…
Copyright OpenHelix. No use or reproduction without express written consent

32. VisiGene Results List of results Select one to view Links and details
The VisiGene data is returned as a page with the images—which can be zoomed in or out, and are all linked to the publications and the appropriate genomic data resources.
On the left is a list of the results, with thumbnail images. You select the image you want from that list and it will be displayed on the right in larger form. More details about the image and the source will be shown at the bottom of the page. This is linked to the source, the relevant literature, the gene details in the UCSC Genome Browser and more, when that data is available.
Shown here are in situ hybridizations for mRNA detection, but for other genes and proteins there are also other types of localization as well—such as antibodies and fluorescence expression patterns, and so on.
So, for some more spatial information about your genes of interest—and perhaps some reagents that might help you in your research, please be sure to check out the VisiGene Image Browser.
Copyright OpenHelix. No use or reproduction without express written consent

33. UCSC Genome Browser Agenda
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
[end of VisiGene] That completes our look at the VisiGene Browser.
[beginning of Proteome Browser] In this section we will examine the Proteome Browser.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

34. Proteome Browser Collection of protein level data
Another tool available from UCSC is the Proteome Browser, which collects important protein-level data and presents it for you on a different details page than we have seen for the gene data so far.
From the homepage, click the Proteome or Proteome Browser links from the navigation bars. Alternatively, if you are on a gene details page of interest, you can access the Proteome Browser from the “Links to Tools and Databases” section of the details page.
For our example we will examine a BRCA1 protein page.
Collection of protein level data
Access from homepage or UCSC Gene pages
Copyright OpenHelix. No use or reproduction without express written consent

35. Proteome Browser Results
Protein level data
Exons illustrated, link to browser
Domains, family
On a Proteome Browser page you can get access to many important characteristics of the protein. You can see the exon structure for the protein, and you can click on any exon to load that exon in the Genome Browser.
You can see polarity and hydrophobicity, you can find the molecular weight and isoelectric point from a collection of histograms, and more. This is a handy summary of many of the features of a protein that you might want to know. Additional details about the source and graphical representations of the data are available on the page.
Links to domains, family information, and other structural data may be available. Links to pathways in which this protein participates may be present. The sequence of this protein is provided in FASTA format at the bottom.
You may find useful summary information about your proteins of interest from the Proteome Browser, with handy links for access within and outside of the UCSC Genome Browser as well.
Structure
Pathways
Copyright OpenHelix. No use or reproduction without express written consent

36. UCSC Genome Browser Agenda
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
[end of Proteome Browser] That completes our look at the Proteome Browser.
[beginning of Other Features] In this section we will examine other features at the UCSC site.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

37. Other Features Utilities: other small useful tools
There are many additional useful tools and links available from the UCSC Genome Browser pages, and new items may be added at any time. We encourage you to explore these aspects. I would like to highlight a couple of popular and frequently requested features briefly now.
Often when people are using genome data they find that they need access to the same region in a previous or later genome version. The Batch Coordinate Conversion, or liftOver tool, can accomplish this for you. You simply enter your region of interest, choose the other version you want to examine, and the BLAT algorithm finds the location in the other assembly.
Duster tools are available to clean up sequence files and remove stray characters that might interfere with certain software processes.
A quick phylogenetic tree maker is also available.
Utilities: other small useful tools
liftOver: to migrate between genome versions
Dusters: to clean up stray characters in sequence files
Tree Maker
Copyright OpenHelix. No use or reproduction without express written consent

38. Explore! genomewiki.ucsc.edu
You will find that there are other features of the browser that you were unfamiliar with before these tutorials. We encourage you to look around the site and see if there are other aspects of the site that will assist your studies.
Also, the site is always being improved and expanded. A great way to keep up with the new features are the mailings lists. If you expect to use the UCSC Genome Browser regularly you may find it handy to monitor the activity on the mailing lists. From the “Contact Us” link on the homepage you will have access to an announcement mailing list, an active discussion list, and a list for people who want to create mirrors of the site.
Another place to look for additional information is the genomewiki system.
We hope that the additional tools and features in the UCSC Genome Browser are helpful for your research. Please explore!
Copyright OpenHelix. No use or reproduction without express written consent

39. UCSC Genome Browser Agenda
Introduction
Gene Sorter
in silico PCR
VisiGene Browser
Proteome Browser
Other Features
Exercises
[end of Other Features] That completes our look at the other features.
[beginning of Other Features] In this section we will examine exercises for Additional Tools.
UCSC Genome Browser:
Copyright OpenHelix. No use or reproduction without express written consent

40. Hands-on session for UCSC Additional Tools
Exercises on the handouts
We will walk through them together
2 styles: questions only, and step-by-step
When we are finished the formal exercises, we can help you to investigate issues that you want to understand for your research
Hands-on session for UCSC Additional Tools.
The exercises that match this presentation can be found on the UCSC Genome Browser OpenHelix tutorial homepage—or in your folders if at a live OpenHelix training. You can choose to do some now, or wait until the end.
Exercises on the handouts
We will walk through them together, in live OpenHelix training sessions
2 styles: questions only, and step-by-step. You can chose to just read the question and try to find the answer, or use the checklist guide to hit each item in a step-by-step manner.
When we are finished the formal exercises, we can help you to investigate issues that you want to understand for your research
Copyright OpenHelix. No use or reproduction without express written consent

41. Notice:
The materials and slides offered are for non-commercial use only. Reproduction, distribution and/or use for commercial purposes is strictly prohibited.
Copyright 2010, OpenHelix, LLC
The materials and slides offered are for non-commercial use only. Reproduction, distribution and/or use for commercial purposes is strictly prohibited.
Copyright 2010, OpenHelix, LLC.
Copyright OpenHelix. No use or reproduction without express written consent

42. 42 Thanks for viewing this OpenHelix tutorial.
Copyright OpenHelix. No use or reproduction without express written consent 42 42