1. CH 12

2. Starting……… Getting there……. Got IT!!
I can analyze the molecular basis of heredity by explaining DNA replication, protein synthesis and gene regulation.

3. Remember Nucleic Acids store genetic information
Building blocks = nucleotides
Examples = DNA and RNA
Phosphate group
5 carbon sugar
base

5. Deoxyribonucleic Acid
DNA is the code for proteins which determines traits
DNA  Protein  Trait
Stored in the nucleus
Must be copied to be passed on to new cells
Double Helix shape

6. Components of nucleotides
Phosphate Group
5 Carbon Deoxyribose Sugar
4 Bases
Purines
Adenine
Guanine
Pyrimidines
Thymine
Cytosine
Phosphate group
Deoxyribose sugar (5 carbon)
base

7. Sugar and Phosphate make the “backbone” of the DNA double helix
Base Pairs in center of helix
A = T
C = G
Chargoff’s rule
The %A = %T and %C = %G

9. Which of the following does NOT describe the structure of DNA?
A. double helix
B. nucleotide polymer
C. sugar-phosphate backbone
D. contains adenine-uracil pairs
E. double stranded

10. Which of the following does NOT describe the structure of DNA?
A. double helix
B. nucleotide polymer
C. sugar-phosphate backbone
D. contains adenine-uracil pairs
E. double stranded

11. DNA structure discovery
Watson/Crick/Franklin- 1953
They discovered the structure of DNA and how it could replicate

12. DNA in the cell NO NUCLEUS DNA located in cytoplasm
Prokaryotes
NO NUCLEUS
DNA located in cytoplasm
1 large circular piece of DNA = chromosome
Small circular pieces of DNA = plasmids

13. DNA in the cell Eukaryotes
Long strands of DNA located in nucleus = chromosomes
DNA tightly coiled around proteins
# of chromosomes vary for different species
Humans = 46 chromosomes

14. Remember
The mitochondria and chloroplast have their own DNA separate from the nuclear DNA in eukaryotic cells
Mitochondria DNA
inherited from mother
In mammals
Has been used to

15. A scientist analyzed several DNA samples to determine the relative proportions of purine and pyrimidine bases. Her data shows 35% adenine bases. What would be the expected % of cytosine?
A. 35%
B. 30%
C. 15%
D. 70%

16. A scientist analyzed several DNA samples to determine the relative proportions of purine and pyrimidine bases. Her data shows 35% adenine bases. What would be the expected % of cytosine?
A. 35%
B. 30%
C. 15%
D. 70%
Remember %A = %T and %C=%G and all percents must add to 100%.
(%A+ %T) + (%C + %G) = 100%
(35% + 35%) + (%C +%G) = 100%
70% + (%C + %G) = 100%
%C + %G = 30%
15% (C)+ 15%(G) = 30%

17. Ribonucleic Acid RNA is generally a copy of a DNA gene
DNA RNA  Protein  Trait
Made in the nucleus but can move throughout the cell
3 types of RNA

18. mRNA
rRNA
tRNA
Messenger RNA
Ribosomal RNA
Transfer RNA
Copies of genes from DNA
Make up ribosomes
Transfer amino acids to ribosomes

19. Components of nucleotides
Phosphate Group
5 Carbon Ribose Sugar
4 Bases
Purines
Adenine
Guanine
Pyrimidines
Uracil
Cytosine
Phosphate group
Ribose sugar (5 carbon)
base

20. DNA
RNA
Bases
Sugar
Shape
Location
Types

21. In which of the following ways does RNA differ from DNA?
A. RNA contains uracil and deoxyribose.
B. RNA contains ribose and thymine.
C. RNA contains uracil and ribose.
D. RNA contains adenine and ribose.
E. RNA contains uracil, thymine, and ribose.

22. In which of the following ways does RNA differ from DNA?
A. RNA contains uracil and deoxyribose.
B. RNA contains ribose and thymine.
C. RNA contains uracil and ribose.
D. RNA contains adenine and ribose.
E. RNA contains uracil, thymine, and ribose.

23. 12-2 DNA Replication
During DNA replication, the DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing. Each strand of the double helix of DNA serves as a template, or model, for the new strand.

24. 1. DNA bases separate by enzyme helicase
2. Enzyme DNA polymerase adds new bases to old strand
3. Proofreading by DNA polymerase
Each new piece of DNA
has a new strand and an old strand = semiconservative replication
Is identical in base pair sequences

25. Replication DNA Replication: make an identical strand of DNA location?
______________________________
_________________________________________
TACGATGCGTCGTCCCCCTGTAACATT
 ______________________________
Enzymes: 

26. 12-3: Protein Synthesis DNA RNA  Protein  Trait
Genes are sections of DNA that code for a protein

27. DNA RNA  Protein  Trait

28. Transcription
DNA mRNA
1. RNA polymerase binds to DNA and separates the DNA strands.
2. RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA
Promoters are regions of DNA that enzymes bind to which starts transcriptions

30. Transcription: make a single strand of mRNA
location?
DNA: TACGATGCGTCGTCCCCCTGTAACATT
mRNA:_______________________________
enzyme:

31. Translation
mRNA  Protein During translation, the cell uses information from messenger RNA to produce proteins.
tRNA
rRNA

33. Translation: make a polypeptide from mRNA
location?
mRNA: _____________________________________
circle the codons above
Name the amino acids:
_____ _____ _____ _____ _____ _____ _____

34. Codon- 3 base sequences of mRNA that codes for an amino acid
Ex) AAAGGGCCC

36. Which of the following nucleotide(s) bond(s) with adenine?
A. thymine only
B. uracil only
C. cytosine and guanine
D. thymine and uracil
E. thymine, uracil, and cytosine

37. Which of the following nucleotide(s) bond(s) with adenine?
A. thymine only
B. uracil only
C. cytosine and guanine
D. thymine and uracil
E. thymine, uracil, and cytosine

38. Make corrections… DNA: TAC CCC GAC ATA CTT AAG
mRNA: AUG GCG CUG UAA GAA UUU
AA: Met Ala Leu Tyr Asp Phe

39. Review Replication Transcription Translation Starts with Ends with
Base Pairs
Location

40. Mutations A change in the genetic code Caused by:
A mistake in DNA replication
ATTCGGC  ATCCGGC
Carcinogens- chemicals that cause DNA mutations
UV (ultaviolet) light
Nuclear radiation

41. Kinds of mutations point mutations- change in one nucleotide
substitution- switch one nucleotide with another
DNA: GCATGC
mutation: CCATGC
Insertion/Addition- add a nucleotide
mutation: GCAATGC
Deletion- remove a nucleotide
mutation: GCAGC
chromosome mutations- change in number or structure of chromosome or chromosomes
inversion, deletion
polyploidy

42. Significance of Mutations
Remember!! DNA  Protein  Trait
most mutations have little or no affect on organism
ex) point mutations
If mutation is for same amino acid there is no change in the protein
some mutations harmful
ex) substitution, Sickle Cell
hemoglobin: GGGCTTCTTTTT
Sickle hemoglobin: GGGCATCTTTTT
ex) addition/deletion are frameshift mutations- change codons = change protein
ex) deletion, CF
ex) addition, Huntington's 

43. Catalyst: Vocab Matching ___ Gene ___ Semi-conservative ___ A, T, G, C
___ A, U, G, C
___ DNA Replication
___ Transcription
___ Translation
___ Nucleotide
___ Deoxyribose
___ Ribose
___ tRNA
___ mRNA
___ rRNA
Produces mRNA from a gene in DNA
Bases found in RNA nucleotides
Section of DNA that codes for a protein
Makes up ribosomes
Sugar found in DNA nucleotides
Sugar, base and phosphate
Transfers amino acids to ribosomes during protein synthesis
Produces an identical strand of DNA
Produces protein from mRNA in the ribosome
Bases found in DNA nucleotides
Carries instructions for the assembly of amino acids
Sugar found in RNA nucleotides
Replication that results in two DNA molecules with one new strand and one original strand

44. Review Protein Synthesis
Summarize OR diagram the process

45. 12-4: Gene Regulation

47. Aliens…

48. Who figured genetics out?
Gregory Mendel
Watson/Crick/Franklin- 1953
There is a hereditary chemical organisms pass on to their offspring
the structure of DNA and how it could replicate