1. V. RNA
Ribonucleic acid

2. Intro
The genes in DNA code for instructions that control the production of proteins within the cells
The first step in decoding these genetic messages is to copy DNA into RNA (transcription)
These RNA molecules contain coded information for making proteins. (translation)

4. A. The Structure of RNA RNA consists of a long chain of nucleotides.
Each nucleotide is made up of
5-Carbon sugar
A phosphate group
A nitrogenous base

5. B. DNA vs. RNA There are three main differences between RNA and DNA:
The sugar in RNA is ribose (instead of deoxyribose)
RNA is single-stranded
RNA contains uracil instead of thymine
So A pairs with U in RNA

7. C. Types of RNA Main function of RNA molecules is protein synthesis.
The assembly of amino acids into proteins is controlled by RNA.  
Three main types of RNA:
messenger RNA
ribosomal RNA
transfer RNA.

8. Disposable complementary copy of a gene
1. Messenger RNA (mRNA)
Disposable complementary copy of a gene
Contains instructions for assembly of a protein
Transfers code from nucleus to ribosomes in the cytoplasm
Exits through nucleopores

9. Makes up part of the ribosome
2. Ribosomal RNA (rRNA)
Makes up part of the ribosome
Reminder: Ribosomes are where proteins are made
Ribosomes are made up of several dozen proteins and RNA

10. Transfers amino acids to the ribosome.
3. Transfer RNA (tRNA)
Transfers amino acids to the ribosome.
One end- holds amino acid
Opposite end- Called the anticodon- can attach tRNA to mRNA

12. HW
Write out questions!
Make a Venn diagram to compare/contrast RNA and DNA.
Answer in complete sentences:
Describe how each type of RNA will contribute to protein synthesis.
Make a Venn Diagram for #1

13. VI. Protein Synthesis A. Overview Transcription Translation In Nucleus
DNARNA
Translation
In cytoplasm on ribosome
RNA protein

14. B. Transcription
RNA molecules are produced by copying part of a sequence of DNA into a sequence in RNA

15. Steps to Transcription:
RNA polymerase binds to a beginning of a gene on a region of DNA called a promoter.
A promoter is a sequence of DNA that acts as a start site.
Enzymes (helicase) start to unwind the DNA double helix, separating the base pairs
Using one of the strands as a template, RNA polymerase reads the bases and makes a complementary strand
Continues until a stop signal is reached-Terminator
RNA breaks free and can leave the nucleus

16. A single gene can produce several different forms of RNA.
Very small changes in DNA or RNA sequences have dramatic effects in gene expression.
Called mutations

18. Practice Transcribe the following sequences of DNA AAA GGG TTT CCC
TAC CGA AAT CAT

19. C. TRANSLATION
The decoding of an mRNA message into a polypeptide chain (protein) is known as translation. (RNA  Protein)
Translation takes place on ribosomes.  
Protein Synthesis

20. A sequence of 3 nucleotides on mRNA is called a codon.
1. CODONS
A sequence of 3 nucleotides on mRNA is called a codon.
Codons can code for:
The start of a polypeptide chain
Start codon= AUG (Methionine)
One of 20 Amino acids (See chart)
The end of a polypeptide chain
Stop codons= UAA, UAG, UGA

23. DNA Code
AGCGTGCCA
mRNA code
UCGCACGGU
mRNA codon UCG-CAC-GGU write the amino acids that correspond to the codons on page 194

24. Answer
Serine
Histine
Glycine

25. 2. Anti-codon
3 nucleotides on tRNA that are complementary to a codon on mRNA
tRNA is carrying the amino acid that the mRNA codon codes for
(this is how the correct amino acid is put into place in the polypeptide chain)

26. 3. Process of Translation
Messenger RNA is transcribed from DNA in the nucleus and released into the cytoplasm
Translation:
Initiation- mRNA molecule attaches to a ribosome
Elongation- Amino acids are transferred to the growing polypeptide chain
Termination- A stop codon is reached, and the protein is released from the ribosome.
PSTQ

28. VII. The Roles of RNA and DNA
The cell uses the vital DNA master plan to prepare RNA blueprints
The DNA molecule remains within the safety of the nucleus, while RNA molecules go to the protein- building sites in the cytoplasm of the ribosomes.

29. A. Genes and proteins
Genes contain nothing more than instructions for assembling proteins.
Ex: A gene that codes for an enzyme to produce pigment can control the color of a flower.
Ex: Another gene produces an enzyme specialized for the production of red blood cell surface antigen (determines blood type).
Proteins are microscopic tools, each specifically designed to build or operate a component of a living cell.

30. Exit Slip Transcribe and translate the following DNA sequence:
TAC TTA GGG CAT ATT
NEXT DAY REVIEW

31. HW
1. During transcription, in what direction do you expect the mRNA to be made? (think about 5’ and 3’ ends) 2. During translation, what would you expect to happen if a stop codon: a: is reached early? b: is never reached? 3. Transcribe and translate the following DNA sequence: TAC TTA GGG CAT ATT

32. Starter
Use the following strand of DNA to make a protein: CGTAGTACCTCCATAAAACT ***Remember: AA chain/codons do not begin until a start codon