1. Ch. 12.4 Mutations Section Objectives:
Categorize the different kinds of mutations that can occur in DNA.
Compare the effects of different kinds of mutations on cells and organisms.

2. Mutations
Any change in DNA sequence is called a mutation.
Mutations can be caused by errors in replication, transcription, cell division, or by external agents.
If mutation occurs in gametes (sex cells) it will be passed on to offspring
A mutation may produceno change, a new trait, or it may result in a protein that does not work correctly.
If the mutation results in a protein that is nonfunctional, and the embryo may not survive.
In some rare cases a gene mutation may have positive effects.

3. Mutations
If mutation takes place in a somatic cell, it is not passed on to organism’s offspring
Damage to a gene may impair the function of the cell
When that cell divides, the new cells also will have the same mutation
Some mutations of DNA in body cells affect genes that control cell division.
This can result in the cells growing and dividing rapidly, producing cancer.

4. Characteristics of Mutations
One of the main sources of genetic variation.
Unique traits are thought to originate through mutations that are passed on
Occur at random
sometimes a mistake in base pairing during DNA replication.
many mutations are caused by factors in the environment
Can be classified as either:
Gene Mutations
Chromosomal Mutations

5. Gene Mutations Changes that affect the nucleotide sequence of a gene
change the DNA
changes the mRNA
may change protein
may change trait
DNA
TACGCACATTTACGTACG
mRNA
AUGCGUGUAAAUGCAUGC aa
protein
trait

6. Types of gene mutations
Changes to the letters (A,C,T,G bases) in the DNA
point (or substitution) mutation
change to ONE letter (base) in the DNA
may cause change to protein, may not
frameshift mutation
addition of a new letter (base) in the DNA sequence
deletion of a letter (base) in the DNA
both of these shift the DNA so it changes how the codons are read
big changes to protein!

7. Point Mutations One base change THEFATCATANDTHEREDRATRAN
can change the meaning of the whole protein
THEFATCATANDTHEREDRATRAN
THEFATCARANDTHEREDRATRAN OR
THEFATCATENDTHEREDRATRAN

8. Point Mutations Substitution mutation = may change amino acid
AUGCGUGUAUACGCAUGCGAGUGA
MetArgValTyrAlaCysGluStop
AUGCGUGUAUACGUAUGCGAGUGA
MetArgValTyrValCysGluStop

9. Sickle cell anemia- a single substitution
Hemoglobin protein in red blood cells
strikes 1 out of 400 African Americans
limits activity, painful & may die young

10. Sickle Cell Anemia- substitution
Does convey resistance to malarial infections when heterozygous
Single substitution, adenine for thymine= defective form
Homo rec-brain damage, heart and lung damage

11. Point Mutations Substitution mutation = may be no change to protein
AUGCGUGUAUACGCAUGCGAGUGA
MetArgValTyrAlaCysGluStop
AUGCGUGUAUACGCUUGCGAGUGA
MetArgValTyrAlaCysGluStop

12. Point Mutations Substitution mutation = may change to STOP
AUGCGUGUAUACGCAUGCGAGUGA
MetArgValTyrAlaCysGluStop
AUGCGUGUAUAAGCAUGCGAGUGA
MetArgValStop

13. Frameshift Mutations THEFATCATANDTHEREDRATRAN
Add or delete one or more bases
changes the meaning of the whole protein as it changes how the mRNA codons are read. This change causes all remaining codons to be incorrectly grouped. The change in “reading frame” causes all resulting proteins to be made improperly.
THEFATCATANDTHEREDRATRAN
THEFATCANTANDTHEREDRATRAN
THEFATCAANDTHEREDRATRAN OR

15. Frameshift Mutations Insertion = add one or more bases-
AUGCGUGUAUACGCAUGCGAGUGA
MetArgValTyrAlaCysGluStop
AUGCGUGUAUACGUCAUGCGAGUGA
MetArgValTyrValMetArgValA

16. Frameshift Mutations Deletion = lose one or more bases
AUGCGUGUAUACGCAUGCGAGUGA
MetArgValTyrAlaCysGluStop
AUGCGUGUAUACGAUGCGAGUGA
MetArgValTyrAspAlaSerGA

17. Chromosome mutations
Chromosome mutations- changes in the structure of a chromosome or the loss of a chromosome. Often occur during cell division.
Deletion- loss of a piece of a chromosome due to breakage. Information carried by the missing piece is lost.
Inversion- a chromosomal segment breaks off and reattaches in the reverse orientation on the same chromosome.

18. Chromosome mutations cont.
Translocation- a chromosomal segment breaks off and attaches to another, non-homologous chromosome.
Nondisjunction- results from the failure of a chromosome to separate from its homologue during meiosis. During nondisjunction, one gamete receives an extra copy, and the other gamete is missing the chromosome entirely.

20. Patterns of Inheritance
Nondisjunction- failure of the chromosomes to separate correctly during cell division.
Monosomy- and individual is missing one of a pair of particular chromosomes (the total number would be 45 for humans)
Turner syndrome- individual only has 1 X chromosome; results in a female with immature physical development, sterility, and a webbed neck.

21. Chromosomes Don’t Separate Properly during Meiosis

22. Nondisjunction Also Can Change the Number of Sex Chromosomes
Turner syndrome
Missing an X chromosome; XO
Female; webbed neck; no secondary sexual traits at puberty; sterile; may age prematurely
XXX females
Develop normally

23. Turner Syndrome

24. Nondisjunctions cont.
Trisomy- an individual has 3 of a particular chromosome. (total number would be 47 for humans)
Down syndrome- extra chromosome at number 21- individual has mental deficiencies, folded skin above the eyes, weak muscles
Kleinfelter’s syndrome- genotype XXY male- has mental retardation, and low fertility.

25. In Down Syndrome There Are Three Copies of Chromosome 21

26. Nondisjunction Also Can Change the Number of Sex Chromosomes
Klinefelter syndrome (XXY)
Low fertility; mental retardation; small testes; sparse body hair; enlarged breasts
Testosterone injections may reverse the phenotype
XYY condition
Taller
Normal male phenotype

27. Kleinfelter’s Syndrome

28. Induced Mutations Mutagen- environmental factor that damages DNA.
Sunlight (UV light) causing skin cancer.
Radiation causing infertility or cancer
X-rays
Chemicals like pesticides and herbicides
Nuclear Radiation
Asbestos
Formaldehyde
Pathogens- frogs with extra legs