1. Preliminary Evidence of Babesia duncani found in Delaware Ticks
Rita Dabaj, AAS, Dr. Michael Buoni, & Lori Maramante, MA
Delaware Technical Community College, Georgetown, DE
INTRODUCTION:
METHODS:
DISCUSSION:
Tick borne infections such as Lyme Disease are a serious concern for adults and children living in endemic areas such as Delaware. Lyme Disease is caused by the bacteria Borrelia burgdorferi. Ticks in our area also carry other pathogenic organisms including bacteria that cause Rocky Mounted Spotted Fever, Anaplasmosis, Erlhlichiosis and Bartonelliosis.
In addition, ticks are also vectors for various viruses and the malaria-like protozoans known as Babesia. Babesia infects and effects red blood cells and often presents with a high grade fever at onset, night sweats, and potentially respiratory symptoms, etc. Untreated, Babesia infections have the potential to be deadly.
Babesia microti is endemic to New England and is understood to be a potential pathogen in the Mid-Atlantic area. Babesia duncani was first discovered in the 1990’s in Washington state and has been considered to be a West Coast species. Anecdotal patient information indicates its presence in Maryland and Delaware.
Ticks were collected from Delaware Tech-Owens Campus and from Redden Forest in Georgetown, Delaware using the drag cloth method. Each tick was placed in a small plastic bag which was then labeled with the collection location, time, date, and weather. Back in the laboratory, the ticks were each examined under the microscope and identified as deer ticks, lone star ticks, or dog ticks using the Tick Encounter Resource Center website for reference ( After identifying the ticks, I performed DNA extraction and purification for 28 individual ticks following the QIAGEN supplementary protocol and using the QIAGEN DNeasy blood & tissue kit (Kit #69504) to extract the tick DNA and the DNA of the targeted microorganisms present, specifically, Borrelia burgdorferi, Babesia microti and Babesia duncani.
The next step was to design PCR primers to use for amplification of targeted DNA specific to the organism of interest. Five primers were developed based on work by Wilson et al and McDowell, 2015 (see Table 1).
In each PCR tube I added 2μl of the DNA that I isolated from
the tick, 2μl of each of the forward and reverse primers, 7μl of DI
water, and 14μl of the 2x PCR mix. Then I placed all the tubes
in the PCR machine and ran the following PCR program:
a) Hot-start denaturation: 95°C for 5:00 minutes.
b)Three-step cycling repeated 35 times:
Denaturation: 94°C for 30 seconds
Annealing: 55°C for 30 seconds
Extension: 72°C for 1 minute
c) Final Extension: 72°C for 15 minutes
d)Hold: 4°C for one day.
Table 1.
Following PCR, I made 1% agarose gels for the electrophoresis and we ran them for minutes at 125mV. Analysis of the DNA amplicons was then performed using the BIO Rad XR+ Gel Doc system.
Outcomes
Initial results suggest that the protocols designed for this experiment worked to amplify selected amplicons, as evidenced by positive controls of the tick COI gene and positive bands for Babesia amplicons.
The presence of these amplicons suggest that Babesia duncani is present in the population of ticks sampled from Sussex County, Delaware.
Limitations
Consistent with Wilson et al, 2015, we had problems with the genus level primers. The Babesia spp primers listed in Table 1 had limited success in amplifying the desired amplicon.
In addition, there were extra and inconsistent bands in some of the B. duncani lanes of multiple samples, indicating that  the protocol is not yet optimized. Reason for this could be too low of an annealing temperature, or that the may have been contamination from other organisms in the tick.
Implications
Diagnosis of B. duncani infections requires a high level of suspicion and currently the prevalent thought is that it is limited to the West Coast. This perspective typically precludes it from being considered as a possible pathogen for East Coast patients.
If our preliminary results are validated, then there are significant implications of this work for Delaware and the region: 1) medical professionals will need to become aware of this tick borne illness and its treatment, 2) blood banks will need to consider how to protect the blood supply from becoming contaminated with this serious yet evasive red blood cell invading protozoan, and 3) the public will need to become aware of the exposure risks and symptoms.
Next Steps
to find or create better primers for species-level amplicons and B. duncani.
to investigate whether the PCR protocol used is optimum for amplification of these specific
send a post-PCR DNA sample of the suspected positive result to the Delaware Biotechnology Institute for DNA sequencing, to serve as validation.
Gene
Primer
Pairs
Forward
Reverse
Length of
Fragments
COI
HCO1490/
LCO2198
5’GGTCAACAAATCATAAAGATATTGG3’
5’TAAACTTCAGGGTGACC
AAAAAATCA3’
680 bp
Babesia spp.
FlaA outer1/FlaA outer2
5’AAGTAGAAAAAGTCTTAGTAAGAAGGA3’
5’AATTGCATACTCAGTACTATTCTTTATCGCT5’
611 bp
B. duncani
BdITS-F/BdITS-R
5’GCTTCCTAACCCGAGACCAA3’
5’CACTGGCGGGGTGAAAAGTA3’
1768bp
B. microti
BmITS1-F/ BmITS1-R2_mb
5’TCCCATTTGGGTTACGCTGG3’
5’CGTGCAGACAAACCCGCCTT3’
483 bp
PURPOSE:
The purpose of this study was to check local ticks in Delaware for the presence of Babesia duncani to help determine if our local human population is at risk for this potentially serious tick borne infection.
RESULTS:
The tick cytochrome oxidase (COI) band (680 bp) the  positive control, was the strongest band seen and it was observed in all of the ticks where the DNA extraction protocol was successful (25/28 samples). For three of the ticks analyzed, the corresponding gels had no bands beyond the DNA  ladder,  indicating that the DNA extraction protocol failed for those three samples. For the remaining 25 ticks, none of the ticks demonstrated a positive amplicon for Borrelia burgdorferi (Lyme).  Two ticks (2/25) tested positive for Babesia microti based on the amplicon band size.  For Babesia duncani, 14/25 ticks test positive based on amplicon band size.
I also tested the ticks using  a “general” species level set of primers from Wilson et al., 2015 with the goal of identifying Babesia positive hits at the genus level. However, the only two ticks with positive genus level amplicons were negative for both Babesia microti and Babesia duncani while there were 15/25 had positive amplicon for either B. microti or B. duncani.
REFERENCES:
McDowell, J Detection of Lyme Borrelia in Ticks Using PCR Analysis.
Wilson et al Development od Droplet digital PCR for the detection of Babesia microti and Babesia duncani. Exp. Parasitol. 149, 24-31
ACKNOWLEDGEMENTS:
Figure 1. The figure above represents an exemplar of data collected for the majority of ticks that showed positive amplicons for B. microti and B. duncani. Lane 5 served as a positive control for the protocol, as primers were chosen for the cytochrome oxidase I gene of the tick, and hence, should always render a positive amplicon.
I would like to thank the Delaware Governor’s Bioscience Award Committee for this award which made this work possible. I would also like to thank my mentors Professor Lori Maramante and Dr. Michael Buoni at Delaware Technical Community College in Georgetown, Delaware for their support and guidance.  
Babesia Parasites in Dog Blood