Download presentation
Presentation is loading. Please wait.
1
Supplementary materials
MiR-145 Improves Macrophage-Mediated Inflammation Through Targeting Arf6
2
Supplementary table 1-1: Comparison sequences of pYr-MirTarget-arf6-3’UTR plasmid .
Sequence 0: part of sequences for Arf6 3’URT from NCBI Sequence 1: sequences of pYr-MirTarget-arf6-3’UTR plasmid
3
Supplementary table 1-2: Comparison sequences of mutated Arf6 plasmid .
Sequence 0: part of sequences for Arf6 3’URT from NCBI Sequence 1: sequences of mutated Arf6 plasmid, CTGG were mutated into GACC, Predicted binding sequences were AACTGGA at these two white sides.
4
laparoscopic cholecystectomy
Supplementary table 2: General characteristics of patients who provided adipose tissue during surgery number gender age(yr) diabetes height(cm) weitht(kg) BMI(kg/m2) a SBP(mmHg) b DBP(mmHg) c FPG(mmol/l) d 2hPG(mmol/l) e HbA1c(%) groupf Reason for surgery L0032 female 35 /g 164 55 20.45 92 60 4.5 / 5 1 laparoscopic cholecystectomy L0039 49 150 24.44 120 80 5.2 5.6 L0042 46 168 57 20.20 113 72 5.3 L0050 male 52 170 65 22.49 98 70 4.3 L0056 47 166 23.59 130 76 5.8 9.2 6.2 gastric stromal tumor L0059 44 67 23.74 L0062 53 180 22.22 132 90 inguinal hernia F0078 21 161 101 38.96 75 5.70 2 bariatric surgery F0081 28 94.5 33.48 4.6 6.7 5.00 F0087 31 183 127.5 38.07 5.1 7.9 5.80 F0111 175 140 45.71 133 87 6.10 F0114 36 88 31.18 142 82 5.7 8.9 5.30 F0117 25 165 31.96 5.9 5.40 F0123 22 96 34.01 117 4.2 4.1 5.20 F0041 30 Y h 187 151 43.18 148 86 10.4 18.8 9.3 3 F0052 Y 147 48.00 94 12.2 16.5 7.1 F0066 50 172 43.94 123 91 8.4 14.6 7.2 F0085 100 35.43 155 109 7.4 14.8 7.60 F0092 33 97 35.63 126 16 22.4 11.00 F0110 41 159 105 41.53 12.9 20.6 10.70 F0121 185 38.57 136 11.10 BMI: body mass index; b. SBP: systolic blood pressure; c. DBP: diastolic blood pressure; d. FPG: fasting plasma glucose; e. 2hPG: 2-hour plasma glucose. f. Group1 as control group (n=7) means those who were not obese without diabetes. Group 2 is Obesity group(n=7) which means those who were obese without diabetes. Group 3 is Obesity+DM group(n=7) meaning those who were obese with diabetes. g. / means without self-reported information or test results; h. Y means yes, with history of diabetes.
5
a. BMI: body mass index; b. SBP: systolic blood pressure; c
a. BMI: body mass index; b. SBP: systolic blood pressure; c. DBP: diastolic blood pressure; d. FPG: fasting plasma glucose; e. 2hPG: 2-hour plasma glucose. f. Group1 as control group (n=7) means those who were not obese without diabetes. Group 2 is Obesity group(n=7) which means those who were obese without diabetes. Group 3 is Obesity+DM group(n=7) meaning those who were obese with diabetes. g. / means without self-reported information or test results; h. Y means yes, with history of diabetes.
6
Supplementary table 3: Primers sequences lists.
name species sequences Arf6 Human Forward 5’-CCATGAAACCCCACGAGA-3’ Reverse 5’-AGGGCTGCACATACCAGTTC-3’ TNF-alpha Forward 5’- CAGCCTCTTCTCCTTCCTGAT-3’ Reverse 5’- GCCAGAGGGCTGATTAGAGA-3’ IL-1beta Forward 5’- TACCTGTCCTGCGTGTTGAA-3’ Reverse 5’- TCTTTGGGTAATTTTTGGGATCT-3’ MCP-1 Forward 5’- CTCAGCCAGATGCAATCAAT-3’ Reverse 5’- AGCTTCTTTGGGACACTTGC-3’ IL-6 Forward 5’- GCCACTCACCTCTTCAGAACG -3’ Reverse 5’- CAGTGCCTCTTTGCTGCTTTC -3’ IL-10 Forward 5’- GACCACGCTTTCTAGCTGTTG -3’ Reverse 5’- GCTCCCTGGTTTCTCTTCCT -3’ beta-actin Forward 5’- CTGGCTGGCCGGGACCTGACA -3’ Reverse 5’- ACCGCTCGTTGCCAATAGTGATGA -3’ GAPDH B661104, Sangon Biotech, China U6 MPH00001, Applied Biological Materials, Canada miR-145-5p MPH02201, Applied Biological Materials, Canada Universal 3’miRNA Universal MPH00000, Applied Biological Materials, Canada
7
Supplementary figure 1: The mRNA expression of MCP-1, IL-10, and IL-6/IL-10 in miR145 inhibitor transfection miR-145- The mRNA expression of cytokines MCP-1, IL-10, and IL-6/IL-10 in THP-1 cells was determined by qRT-PCR. *p<0.05, **p<0.01, ****p< compared with NC inhibitor, respectively.
8
*p<0.05, ****p<0.0001 compared with NC mimic, respectively.
Supplementary figure 2: The mRNA expression of IL-1beta, IL-10, and IL-6/IL-10 in miR145 mimic transfection miR-145+ The mRNA expression of cytokines IL-1beta, IL-10, and IL-6/IL-10 in THP-1 cells was determined by qRT-PCR. *p<0.05, ****p< compared with NC mimic, respectively.
9
*p<0.05, **p<0.01, compared with negative control, respectively.
Supplementary figure 3: The mRNA expression of IL-10, and IL-6/IL-10 in LV-ARF6-RNAi transfection LV-ARF6-RNAi The mRNA expression of cytokines IL-10, and IL-6/IL-10 in THP-1 cells was determined by qRT-PCR. *p<0.05, **p<0.01, compared with negative control, respectively.
10
of obese patients and diabetics.
Supplementary figure 4: The mRNA expression of IL-10, and Il-6/IL-10 in omental adipose tissue of obese patients and diabetics. Human adipose tissue The mRNA expression of cytokines IL-10, and IL-6/IL-10 in omental adipose was determined by qRT-PCR. *p<0.05, ***p<0.001 compared with control group.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.