Presentation is loading. Please wait.

Presentation is loading. Please wait.

BIOLOGY: DNA, RNA, TRANSCRIPTION, TRANSLATION, & MUTATIONS TEST REVIEW

Similar presentations


Presentation on theme: "BIOLOGY: DNA, RNA, TRANSCRIPTION, TRANSLATION, & MUTATIONS TEST REVIEW"— Presentation transcript:

1 BIOLOGY: DNA, RNA, TRANSCRIPTION, TRANSLATION, & MUTATIONS TEST REVIEW

2 Who were the two people credited with the discovery of the structure of DNA? Watson & Crick

3 In a DNA molecule, list the two combinations of base pairs. A-T, C-G

4 Where does transcription take place in the cell? Nucleus

5 In the figure to the right, what does Structure 1 represent? DNA

6 In the figure to the right, what does Structure 2 represent? mRNA

7 In the figure to the right, where is Structure 2 synthesized? Nucleus

8 What is the name of the process in which the sequence of mRNA is decoded into a protein? Translation

9 How many codons are needed to specify nine amino acids? 9

10 In a developing embryo, there is exposure to a poison that causes guanine to be removed from DNA. Why can this cause serious deformities? It is a part of the genetic code

11 Who studied DNA using a technique called XRAY diffraction? Franklin

12 The circled region of the molecule shown in the diagram is called a
The circled region of the molecule shown in the diagram is called a? nucleotide

13 After the process of DNA REPLICATION occurs, each daughter cell receives an exact copy of the parent cell DNA.

14 If the sequence of bases on one strand of a DNA molecule is ATTGCCCATG, then what will be the sequence on the complementary DNA strand? TAACGGGTAC

15 What is a set of 3 nucleotides in mRNA that is complementary to DNA called? codon

16 In a portion of a gene, the base sequence is T-C-G-A-A-T
In a portion of a gene, the base sequence is T-C-G-A-A-T. Which complementary base sequence would be found bonded to this section of the gene? A-G-C-T-T-A

17 What can be said about the 3 things outlined in the diagram to the right? It is a nucleotide made up of a sugar, phosphate, and a nitrogeneous base.

18 Which molecule carries out the instructions coded in DNA? mRNA

19 Part of DNA is copied in a process called what? transcription

20 Which molecule carries the anticodon of 3 nucleotides that is complementary to the codon of mRNA? tRNA

21 What type of mutation is illustrated in the picture below? Inversion

22 The diagram found below represents a section of a molecule that carries genetic information: What does the pattern of numbers up above represent? a sequence of paired bases

23 Who noticed that each sample of DNA always contained equal amounts of adenine and thymine? Chargaff

24 What happens during transcription? mRNA is produced

25 Give a major difference between DNA replication and DNA transcription
Give a major difference between DNA replication and DNA transcription. RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.

26 What role do DNA helicases have in DNA replication
What role do DNA helicases have in DNA replication? DNA helicases break the hydrogen bonds in the DNA molecule.

27 Are the processes of transcription and translation similar in all organisms? YES

28 What type of mutation occurs when a part of a chromosome is lost
What type of mutation occurs when a part of a chromosome is lost? Deletion

29 What did Griffith call the process when one strain of bacteria were changed into another? Transformation

30 What makes up the part of the DNA outlined in the box below
What makes up the part of the DNA outlined in the box below? Phosphate and sugar (deoxyribose)

31 What amino acid would be transferred to the codon of CAC
What amino acid would be transferred to the codon of CAC? (use the genetic code chart)? Histidine

32 What type of mutation is illustrated in the picture below? Duplication

33 Which genetic change is best described here
Which genetic change is best described here? A chromosomal rearrangement is formed after a section breaks off from one chromosome and attaches to another? Translocation

34 What is the term for a random change in an organism's genetic information? Mutation

35 What part of the cell contains the DNA? Nucleus

36 DNA replication results in 2 DNA molecules
DNA replication results in 2 DNA molecules. How many strands of each are new and how many of each are original? One old & one new strand

37 A mutation occurs at the midpoint of a gene, altering all amino acids encoded after the point of mutation. A deletion of (CHOOSE: 2, 3, 6, or 12) nucleotides could have produced this change?

38 Which nucleotide is present in RNA but not in DNA? Uracil

39 What is the term for each nucleotide triplet in mRNA that specifies a particular amino acid? Codon

40 Cells store genetic information in DNA that is used to synthesize what molecules? Proteins

41 What are the base pairing rules in DNA? A-T, C-G

42 During the process shown above, the 2 strands of 1 DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results in the formation of 2 identical DNA molecules. What is this process known as? DNA REPLICATION

43 Describe the following: Frame shift mutation:insertion and deletion changes reading frame Silent mutation: no noticeable change Nonsense mutation: stop codon prematurely inserted Missense mutation: only one amino acid affected

44 SHORT ANSWERS 1. Using the following DNA code, determine the complementary DNA, the mRNA, the tRNA, and the amino acid sequence. To find the amino acid sequence, you will need your genetic code chart. TACCATTCCGATACCAAGACC Comp DNA: ATGGTAAGGCTATGGTTCTGG mRNA: AUGGUAAGGCUAUGGUUCUGG amino acid: met-val-arg-leu-try-phe-try tRNA: UACCAUUCCGAUACCAAGACC

45 Compare and contrast DNA and RNA
Compare and contrast DNA and RNA. Be sure to give three differences between them. Both composed of nucleotides. RNA carries out the instructions coded in DNA. DNA is double stranded but RNA is single. DNA contains deoxyribose, RNA contains ribose. DNA contains Thymine, RNA contains Uracil.

46 How are replication, transcription, and translation different
How are replication, transcription, and translation different? replication- DNA is used as a template to make more DNA, resulting in 2 DNA molecules each with one old and one new strand. In transcription DNA is used as a template to make RNA (mRNA). In translation the sequence of mRNA is decoded into a protein


Download ppt "BIOLOGY: DNA, RNA, TRANSCRIPTION, TRANSLATION, & MUTATIONS TEST REVIEW"

Similar presentations


Ads by Google