Download presentation
Presentation is loading. Please wait.
1
Quiz#9 LC710 11/28/12 name___________
Given the following transgenes co-existing in the same animal. rtta binds DNA if Dox is present CMVp rtTa I.R.E.S GFP nls=nuclear localization sequence tetO TATA RFP-T2A-nlsCRE Q2 1% pt (circle one) : Q1 1 % (circle one) : Cytosolic Fluorescence observed prior to addition of Doxycycline is: Red Green Both Neither At Steady State, Cytosolic Fluorescence observed after addition of Doxycycline is: Red Green Both Neither Q3: 2% What does tta do in the absence of Dox (be specific)?________________________ What does tta do in the presence of Dox (be specific)?________________________
2
the brain expressing Pax6 and/or Hox1.
Given the following transgenes co-existing in the same animal. 4 3 8 Pax6p 7 12 2 CreERt2 I.R.E.S GFP 11 1 6 Hox1p 5 10 9 loxP-RFP-loxP-TOXIN Above are WT cells in the brain expressing Pax6 and/or Hox1. If expressed, TOXIN will Kill cells (disappear) Q4 (2%) Q5 (2%) Prior to addition of TAM, which Cells are: After TAM addition, which Cells are: Red only: Green only: Both: Neither: Red only: Green only: Both: Neither: TAM= TAMOXIFEN Q6 (2%) : in the above transgene, loxP sites are in the forward orientation: ATAACTTCGTATAATGTATGCTATACGAAGTTAT = loxP sequence forward ATAACTTCGTATAGCATACATTATACGAAGTTAT = loxP sequence reverse This experiment is actually poorly designed and the loxP sites need to oriented as follows: Hox1p Why?
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.