1. DNA vs. RNA

2. Contains sugar, nitrogen base & phosphate
Warm-up: Read the article with a friend and categorize the following: 1 – DNA 2 – RNA 3 - Both
Double Stranded
Contains sugar, nitrogen base & phosphate
Contains nitrogen bases cytosine, guanine, adenine, uracil
Stays in the nucleus
Single stranded
Contains nitrogen bases cytosine, guanine, adenine, thymine

3. Complimentary Strand Practice
Original Strand: GCCATAGGATTTATATGGCATAT
Complementary Strand:
Is this a DNA or 2. RNA Complimentary strand?
How do you know?
Make and RNA complementary strand for the original?
Original Strand: GCCATAGGATTTATATGGCATAT
GCCAUAGGAUUUAUAUGGCAUAU
CGGTATCCTAAATATACCGTATA

4. Check-In What is unique to DNA base pairs compared to RNA base pairs
G-C 
A-T 
A-U 
There is no difference 
Complete the table by writing “DNA” or “RNA” or “Both” in the box.  DNA, RNA, BOTH? 
Double stranded   
Contains the nitrogen bases cytosine,guanine, adenine, and thymine   
Stays in the nucleus   
Single stranded   
Contains the nitrogen bases cytosine,guanine, adenine, and uracil   
Provides the genetic “code” for assembling proteins   
Found in the cytoplasm   
Contains sugar, phosphate, and nitrogen base molecules   

5. Objective
Differentiate the roles of DNA and the 3 forms of RNA in protein synthesis.
DOL: Describe the process of protein synthesis using each of the 7 vocabulary words in a prof. CR.

6. DNA replication Must occur before a cell divides.
Each new cell needs a copy of the information in order to grow.

7. DNA replication. Why needed?
Before DNA strand can be replicated or copied it must be “unzipped”
DNA polymerase (enzyme that unzips)
Starts at many different points. Why?

8. Completing the replication
After the DNA molecule comes apart, bases of free nucleotides in the nucleus join their complimentary bases.

9. RNA Very similar to DNA. Exceptions: Ribose is the 5-carbon sugar
Uracil replaces thymine
Single-stranded

10. RNA
The answer is RNA
RNA – Transfers the information from the DNA into brand new proteins.
mRNA – Messenger RNA
tRNA – Transfer RNA
Ribosomal RNA

11. Where does this happen? Nucleus
mRNA is made in the nucleus and is sent to the cytoplasm of the cell to be used to make new proteins.
DNA is very long. Why wouldn’t the body just send the DNA out of the nucleus to make new proteins? Why bother with mRNA?
Cytoplasm

12. Answer
Since DNA is so long it would take a lot of work to move it all over the cell to make new proteins. Also, if you are only using one set of blueprints you can only make one new protein at a time. With mRNA you can make a lot of proteins at a time.

13. mRNA (messenger) Copies genetic code of DNA by matching bases.
Occurs in the nucleus.
DNA changing to RNA

14. tRNA (transfer) approx. 80 nucleotides in length. Cross-like shape
At one end an amino acid is attached
At the other end there is an anticodon
Acts like a truck

15. What’s Next?
tRNA has two ends: One end carries a piece of the protein (Amino Acid) the other end matches up to the mRNA at the right spot

16. Find Someone Who… DNA mRNA tRNA Ribosome Deoxyribo-nucleic Acid
Abbreviation
Name
What is its Job?
Where is it Found?
DNA
mRNA
tRNA
Ribosome
Deoxyribo-nucleic Acid
Holds body’s Blueprints
Nucleus
Makes a small copy of DNA info, carries to cytoplasm
Nucleus and cytoplasm
Messenger RNA
Carries amino acids to mRNA to make proteins
Transfer RNA
Cytoplasm
Holds the mRNA and tRNA when making proteins
Cytoplasm

17. DOL Example
DNA holds all of the body’s information in the nucleus. A copy of certain parts of that information is made and that copy is called mRNA. This new copy is carried out of the nucleus to the cytoplasm to the ribosome where tRNA carries amino acids over to be matched up with each other based on the instructions in the mRNA. The final result is a new protein molecule.